MUSS0073, MUSS0073 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUSS0073
AliasMUSS073
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTTTTA(3)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS073_F: TCTCCATGAAACCAAACAAACC
Primer 2MUSS073_R: TTAATGCTATTTTCTCCGTCGC
Product Length217
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS073_FMUSS073_FGossypium arboreumprimer
MUSS073_RMUSS073_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS073MUSS073Gossypium arboreummarker_locus
muss0073muss0073Gossypium arboreummarker_locus
MUSS073bMUSS073bGossypium arboreummarker_locus
MUSS073aMUSS073aGossypium arboreummarker_locus
MUSS073/200yMUSS073/200yGossypium arboreummarker_locus
MUSS073MUSS073-65.311Gossypium arboreummarker_locus
MUSS073bMUSS073b-52.726Gossypium arboreummarker_locus
MUSS073aMUSS073a-50.409Gossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:9263099..9263297 +
A02chromosomeA02:77974133..77974346 -
CM018217.1chromosomeCM018217.1:8838155..8838352 +
CM018203.1chromosomeCM018203.1:88505143..88505373 -
D5_02chromosomeD5_02:8073057..8073254 +
Chr2chromosomeChr2:84747005..84747219 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:13075073..13075286 +
Chr3chromosomeChr3:22440132..22440402 +
At_chr9chromosomeAt_chr9:21616682..21616895 +
At_chr3chromosomeAt_chr3:46352516..46352729 +
Dt_chr3chromosomeDt_chr3:26669527..26669787 -
D03chromosomeD03:8895567..8895780 +
A02chromosomeA02:71758948..71759161 -
Ghir_D03chromosomeGhir_D03:9009091..9009289 +
Ghir_A02chromosomeGhir_A02:95845058..95845271 -
D03chromosomeD03:8722561..8722759 +
A02chromosomeA02:96516987..96517200 -
D03chromosomeD03:9053550..9053748 +
A02chromosomeA02:93924860..93925073 -
D03chromosomeD03:8875236..8875435 +
A02chromosomeA02:92255900..92256114 -
Dt03chromosomeDt03:10896692..10896889 +
scaffold8090supercontigscaffold8090:79926..80123 +
scaffold1470supercontigscaffold1470:320925..321155 +
scaffold1470supercontigscaffold1470:315706..315936 +
Gbar_D03chromosomeGbar_D03:8858402..8858596 +
Gbar_A02chromosomeGbar_A02:88573692..88573922 -
D03chromosomeD03:8938267..8938611 +
A02chromosomeA02:90683691..90683920 -
CM017625.1chromosomeCM017625.1:8882811..8883006 +
CM017611.1chromosomeCM017611.1:92534390..92534601 -
CM017637.1chromosomeCM017637.1:97840986..97841201 -
CM017703.1chromosomeCM017703.1:8979285..8979480 +
CM017689.1chromosomeCM017689.1:90433381..90433611 -
Sequence
>MUSS0073 ID=MUSS0073|Name=MUSS0073|organism=Gossypium arboreum|type=genetic_marker|length=217bp
TCTCCATGAAACCAAACAAACCTTTACAACTTAATACTTGCACAATCAAG
CTCAGCTCAAAAACAAGCTCTACTAAAATCAAGAAAGTATCGCTCTTATT
TTTATTTTATTTTATTTTTTTGGGGGGGGGGGGAGAATTTATTAGAAAAT
CATGAAAATAGAAAAAAGTTGAAAGAGTAAAAGTAGCACCTATTGGCGAC
GGAGAAAATAGCATTAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.0280.74MUSS073View
2TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.02N/AAD_chr.0252.3MUSS073View
3Yumian-1 x T586, RIL (2006)YT-RIL_chr02-2N/AAD_chr.0211.2MUSS073View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.0269.3MUSS073View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0251.9MUSS073View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.0264muss0073View
7TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.0251.92MUSS073bView
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.0252.7MUSS073bView
9TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c17N/AAD_chr.1767.86MUSS073aView
10TM-1 x 3-79, RIL (2014)T3-RIL.14_chr17N/AAD_chr.1750.4MUSS073aView
11Yumian-1 x T586, RIL (2009)YT-RIL_chr02-1N/AAD_chr.0282MUSS073/200yView
12CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0265.31MUSS073View
13TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.0252.73MUSS073bView
14TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.17N/AAD_chr.1750.41MUSS073aView