MUSS0054, MUSS0054 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUSS0054
AliasMUSS054
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTTTTC(3)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS054_F: CTCCATTTTTCGCTTGTCTAGG
Primer 2MUSS054_R: AATGGCAAACAACAATCGTAGG
Product Length143
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS054_FMUSS054_FGossypium arboreumprimer
MUSS054_RMUSS054_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS054MUSS054Gossypium arboreummarker_locus
MUSS054/150tMUSS054/150tGossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:60235229..60235353 -
A01chromosomeA01:99175267..99175409 -
CM018215.1chromosomeCM018215.1:58892297..58892421 -
CM018202.1chromosomeCM018202.1:108379977..108380118 -
Chr2chromosomeChr2:20676747..20676890 -
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:94524879..94525021 -
Chr2chromosomeChr2:1339099..1339223 -
CM016614.1chromosomeCM016614.1:131890223..131890345 -
Dt_chr2chromosomeDt_chr2:49910388..49910530 -
D01chromosomeD01:57483128..57483252 -
A01chromosomeA01:95292825..95292967 -
Ghir_D01chromosomeGhir_D01:59165751..59165875 -
Ghir_A01chromosomeGhir_A01:112863185..112863327 -
A05chromosomeA05:38108859..38109001 +
D01chromosomeD01:60742466..60742590 -
A01chromosomeA01:113424198..113424340 -
D01chromosomeD01:60578581..60578705 -
A01chromosomeA01:111152923..111153065 -
D01chromosomeD01:57816044..57816168 -
A01chromosomeA01:107940257..107940399 -
Dt01chromosomeDt01:58489323..58489447 -
scaffold460supercontigscaffold460:195660..195801 +
scaffold808supercontigscaffold808:253917..254041 -
C30158078supercontigC30158078:1175..1299 -
Gbar_D01chromosomeGbar_D01:59114873..59114997 -
Gbar_A01chromosomeGbar_A01:110857721..110857862 -
A01chromosomeA01:110824122..110824263 -
CM017623.1chromosomeCM017623.1:59987401..59987525 -
CM017610.1chromosomeCM017610.1:109437270..109437412 -
CM017649.1chromosomeCM017649.1:61483055..61483179 -
CM017636.1chromosomeCM017636.1:116839816..116839959 -
CM017701.1chromosomeCM017701.1:59462873..59462997 -
CM017688.1chromosomeCM017688.1:106961167..106961308 -
Sequence
>MUSS0054 ID=MUSS0054|Name=MUSS0054|organism=Gossypium arboreum|type=genetic_marker|length=143bp
CTCCATTTTTCGCTTGTCTAGGTAGATTCCTTTTTTTCTTTTCTTTTCTT
TTTTTTTTTAGTTTTGTTTTCTTGCTGTGAAATTTGGATGTTTTTGGAGA
TGATACGGTCTGGTATACAAACCTACGATTGTTGTTTGCCATT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr01-2N/AAD_chr.0170.5MUSS054
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0171.3MUSS054
3Yumian-1 x T586, RIL (2009)YT-RIL_chr01-2N/AAD_chr.0167.7MUSS054/150t