MUCS0459, MUCS0459 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUCS0459
AliasMUCS459
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifGAA(2)AAGAA(2)
PCR ConditionAnnealing temperature: 55
Primer 1MUCS459_F: TAAGACACGCAAGCCATTTC
Primer 2MUCS459_R: CGCAAGCCACTCCCTTTAC
Product Length240
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUCS459_FMUCS459_FGossypium arboreumprimer
MUCS459_RMUCS459_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUCS459MUCS459Gossypium arboreummarker_locus
mucs0459mucs0459Gossypium arboreummarker_locus
MUCS459-4000MUCS459-4000Gossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:66989320..66989850 +
A03chromosomeA03:103838787..103839316 +
CM018216.1chromosomeCM018216.1:63136369..63136899 +
CM018204.1chromosomeCM018204.1:101654244..101654773 +
D5_03chromosomeD5_03:3840511..3841041 -
KI_03chromosomeKI_03:38974161..38974685 +
Chr5chromosomeChr5:48849548..48850078 -
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:131180042..131180572 +
Chr5chromosomeChr5:30166754..30167285 -
D10_03chromosomeD10_03:3772862..3773392 -
CM016616.1chromosomeCM016616.1:5098310..5098840 -
Dt_chr5chromosomeDt_chr5:10886507..10887037 -
At_chr5chromosomeAt_chr5:51890734..51891263 -
A03chromosomeA03:95948763..95949292 +
Ghir_D02chromosomeGhir_D02:65875700..65876230 +
Ghir_A03chromosomeGhir_A03:108453601..108454130 +
D02chromosomeD02:65927351..65927881 +
A03chromosomeA03:107232208..107232737 +
D02chromosomeD02:67191539..67192069 +
A03chromosomeA03:105538654..105539183 +
D02chromosomeD02:64298816..64299346 +
A03chromosomeA03:100814510..100815039 +
Dt02chromosomeDt02:66654186..66654716 +
scaffold13132supercontigscaffold13132:107512..108041 +
scaffold13132supercontigscaffold13132:109422..109955 +
scaffold10194supercontigscaffold10194:175558..176088 +
Gbar_D02chromosomeGbar_D02:63734283..63734813 +
Gbar_A03chromosomeGbar_A03:100812969..100813498 +
D02chromosomeD02:64999943..65000473 +
A03chromosomeA03:103162289..103162818 +
CM017624.1chromosomeCM017624.1:66074794..66075324 +
CM017612.1chromosomeCM017612.1:102441815..102442344 +
CM017650.1chromosomeCM017650.1:67694873..67695403 +
CM017638.1chromosomeCM017638.1:109606720..109607249 +
CM017702.1chromosomeCM017702.1:64616448..64616978 +
CM017690.1chromosomeCM017690.1:103586512..103587041 +
Chr05chromosomeMUCS0459:8..496 .
Chr05:60348219..60349002 +
Chr5chromosomeMUCS0459:8..496 .
Chr5:30166653..30167436 -
Sequence
>MUCS0459 ID=MUCS0459|Name=MUCS0459|organism=Gossypium arboreum|type=genetic_marker|length=240bp
TAAGACACGCAAGCCATTTCAAAGTGATGGGGTAGCTCATGCTGCTGCAA
CACAAATCCAGAAAAAATTTCGTGGTTGGAAGAAAAGAAAAGAATTCTTA
TTGATCCGGCAAAGAATTGTCAAAATTCACGCCCATGTCAGAGGACACCA
GGTGCGGAAACAGTATAAAACTTTTGTCTGGTCAGTGGGAATTCTGGAGA
AAGTTATTTTACGGCGGAGACGTAAAGGGAGTGGCTTGCG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A02N/AA_chr.0238.6MUCS459View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr14N/ADt.02111.7MUCS459View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr14N/AAD_chr.14201mucs0459View
4TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr14N/AAD_chr.1431.6MUCS459-4000View
5TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr14/D2N/AAD_chr.1433MUCS459-4000View