MUCS0425, MUCS0425 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUCS0425
AliasMUCS425
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifAGGAA(2)CCT(2)
PCR ConditionAnnealing temperature: 55
Primer 1MUCS425_F: CCATCTCTTTCGCTATCTGC
Primer 2MUCS425_R: ACGGCTCTCCTCTTTCTGC
Product Length298
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUCS425_FMUCS425_FGossypium arboreumprimer
MUCS425_RMUCS425_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUCS425MUCS425Gossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:20945527..20945824 -
A05chromosomeA05:22739318..22739615 -
CM018219.1chromosomeCM018219.1:19781428..19781725 -
CM018206.1chromosomeCM018206.1:21802759..21803056 -
D5_05chromosomeD5_05:18547171..18547468 -
KI_05chromosomeKI_05:16698595..16698892 -
Chr4chromosomeChr4:34875136..34875433 +
Chr12chromosomeChr12:71335935..71336232 +
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:22306552..22306849 -
Chr9chromosomeChr9:25313949..25314246 +
D10_05chromosomeD10_05:41772733..41773030 +
CM016618.1chromosomeCM016618.1:90128455..90128752 +
At_chr9chromosomeAt_chr9:38893979..38894276 +
Dt_chr9chromosomeDt_chr9:48020277..48020574 -
scaffold72077supercontigscaffold72077:85..382 +
D05chromosomeD05:20162036..20162333 -
A05chromosomeA05:20126792..20127089 -
A05chromosomeA05:20121217..20121514 -
Ghir_D05chromosomeGhir_D05:20261995..20262291 -
Ghir_A05chromosomeGhir_A05:22334382..22334679 -
D05chromosomeD05:19796569..19796866 -
A05chromosomeA05:21686063..21686360 -
D05chromosomeD05:20111889..20112186 -
A05chromosomeA05:22367164..22367461 -
D05chromosomeD05:19988455..19988752 -
A05chromosomeA05:22532089..22532386 -
At05chromosomeAt05:17269734..17270031 -
At05chromosomeAt05:17261695..17261992 -
scaffold9514supercontigscaffold9514:108347..108644 +
scaffold1798supercontigscaffold1798:191578..191875 -
scaffold1798supercontigscaffold1798:183539..183836 -
Gbar_D05chromosomeGbar_D05:20144264..20144561 -
Gbar_A05chromosomeGbar_A05:21471571..21471868 -
D05chromosomeD05:20150845..20151142 -
A05chromosomeA05:22162761..22163058 -
CM017627.1chromosomeCM017627.1:19970691..19970988 -
CM017614.1chromosomeCM017614.1:21960485..21960782 -
CM017653.1chromosomeCM017653.1:20418720..20419017 -
CM017640.1chromosomeCM017640.1:22309111..22309408 -
CM017705.1chromosomeCM017705.1:20090077..20090374 -
CM017692.1chromosomeCM017692.1:21694720..21695017 -
Chr09chromosomeMUCS0425:14..605 .
Chr09:18508830..18509421 -
Chr9chromosomeMUCS0425:14..605 .
Chr9:25313774..25314365 +
Sequence
>MUCS0425 ID=MUCS0425|Name=MUCS0425|organism=Gossypium arboreum|type=genetic_marker|length=298bp
CCATCTCTTTCGCTATCTGCCTTTTCCCTTTCTCTCTATCTGATTCCTAT
CGACAATGGCCGCCGCCGCCACTTCTTCACCCCGCGAGGAAAATGTCTAC
ATGGCGAAACTCGCCGAGCAAGCCGAACGCTACGAGGAAATGGTTGAGTT
CATGGAGAAAGTCTCTGCCTCCGCCGACAACGAGGAGCTCACCGTCGAGG
AAAGGAACCTCCTCTCCGTCGCTTACAAGAATGTTATCGGCGCTCGCCGT
GCTTCCTGGCGCATCATTTCCTCCATTGAGCAGAAAGAGGAGAGCCGT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A01N/AA_chr.0115.7MUCS425View