MUCS0359, MUCS0359 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUCS0359
AliasMUCS359
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTGGT(2)GACTT(2)
PCR ConditionAnnealing temperature: 55
Primer 1MUCS359_F: GAGCTTGGTTGGTTTCAAGC
Primer 2MUCS359_R: CCCCCTGTGATCTTTTTACG
Product Length227
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUCS359_FMUCS359_FGossypium arboreumprimer
MUCS359_RMUCS359_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUCS359-bMUCS359-bGossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D08chromosomeD08:57163816..57164452 +
A08chromosomeA08:109025820..109026452 +
CM018222.1chromosomeCM018222.1:53684577..53685215 +
CM018209.1chromosomeCM018209.1:104498816..104499453 +
D5_08chromosomeD5_08:49996757..49997394 +
Chr3chromosomeChr3:13129917..13130552 +
Chr08_CRI-A2_v1.0.a1chromosomeChr08_CRI-A2_v1.0.a1:113758747..113759382 +
Chr8chromosomeChr8:59307720..59308358 -
D10_08chromosomeD10_08:11036962..11037600 -
CM016621.1chromosomeCM016621.1:20079511..20080147 -
Dt_chr13chromosomeDt_chr13:8725707..8726344 +
At_chr5chromosomeAt_chr5:29715003..29715641 +
D08chromosomeD08:53755373..53756011 +
A08chromosomeA08:90454364..90455001 +
Ghir_D08chromosomeGhir_D08:56384633..56385271 +
Ghir_A08chromosomeGhir_A08:108336993..108337630 +
D08chromosomeD08:57223602..57224240 +
A08chromosomeA08:111349230..111349867 +
D08chromosomeD08:56279685..56280323 +
A08chromosomeA08:111154051..111154688 +
D08chromosomeD08:53559237..53559875 +
A08chromosomeA08:107155953..107156590 +
scaffold7581supercontigscaffold7581:149788..150425 -
scaffold7581supercontigscaffold7581:142467..143105 -
scaffold13515supercontigscaffold13515:26292..26929 -
scaffold13515supercontigscaffold13515:23128..23765 -
Scaffold1773supercontigScaffold1773:11203..11840 +
Gbar_D08chromosomeGbar_D08:53652597..53653235 +
Gbar_A08chromosomeGbar_A08:105081333..105081970 +
D08chromosomeD08:55697341..55697979 +
A08chromosomeA08:106342042..106342679 +
CM017630.1chromosomeCM017630.1:55172982..55173620 +
CM017617.1chromosomeCM017617.1:104787066..104787703 +
CM017656.1chromosomeCM017656.1:57309382..57310277 +
CM017643.1chromosomeCM017643.1:114302132..114302769 +
CM017708.1chromosomeCM017708.1:54314606..54315244 +
CM017695.1chromosomeCM017695.1:105362897..105363534 +
Sequence
>MUCS0359 ID=MUCS0359|Name=MUCS0359|organism=Gossypium arboreum|type=genetic_marker|length=227bp
GAGCTTGGTTGGTTTCAAGCAACAGCTTCTGGTTACTATCAGCTGGGCAT
CGTAGTAGTGGTTGGTGACTTGACTTTTCACAATTTGCACCATCCCGATT
TGTCAGATAGAAGCAATGATGGATACCCAAGGAACGATGCTGCATCTGCA
GGCAAAAACCCTAAACTACTCCAGCAAAGTTGGCCATACCCAAGTCATGC
ATTATCTCGTAAAAAGATCACAGGGGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A02N/AA_chr.0253.1MUCS359-bView