MGHES0024, MGHES0024 (genetic_marker) Gossypium hirsutum

Marker Overview
NameMGHES0024
AliasMGHES24
MGHES-24
MGHES-024
MGHES0024=ECU-E3569=RC(ECU-E3570)
ECU-E3570
ECU-E3569
Genbank IDAW587511
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Source SequenceAW587511.1
Source TypeEST
Repeat Motif(GCA)6; (CAA)3
PCR ConditionAnnealing temperature: 55
Primer 1MGHES24_F: CGCAACAACTGATGCAACTC
Primer 2MGHES24_R: AACCGATACCTCCGCTTCTT
Product Length205
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAW587511
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MGHES24_FMGHES24_FGossypium hirsutumprimer
MGHES24_RMGHES24_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.GG-RIL.16_ch02-2.hd12.3Gossypium hirsutumQTL
fiber strengthqFS.GG-RIL.16_ch02-2.hd12Gossypium hirsutumQTL
seed indexqSI.GG-RIL.16_ch02-2.cz12-bcGossypium hirsutumQTL
seed indexqSI.GG-RIL.16_ch02-2.hd12-rilGossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MGHES24MGHES24Gossypium hirsutummarker_locus
mghes0024mghes0024Gossypium hirsutummarker_locus
MGHE24MGHE24Gossypium hirsutummarker_locus
MGHES24MGHES24-73.901Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AW587511.1AW587511.1Gossypium hirsutumsequence_feature


Publications
YearPublication
2004EST-SSR: A new class of genetic markers in cotton.
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:7263756..7263963 -
D03chromosomeD03:7231223..7231436 -
A02chromosomeA02:82552263..82552476 -
A02chromosomeA02:82526430..82526643 -
CM018217.1chromosomeCM018217.1:6911656..6911863 -
CM018217.1chromosomeCM018217.1:6876444..6876657 -
CM018203.1chromosomeCM018203.1:92739552..92739762 -
CM018203.1chromosomeCM018203.1:92713804..92714017 -
D5_02chromosomeD5_02:6084201..6084411 -
D5_02chromosomeD5_02:6054273..6054486 -
KI_06chromosomeKI_06:45252223..45252430 -
Chr2chromosomeChr2:61475432..61475648 -
Chr2chromosomeChr2:61453451..61453664 -
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:7832688..7832904 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:7854664..7854877 +
Chr3chromosomeChr3:20143743..20143953 -
Chr3chromosomeChr3:20114496..20114709 -
D10_02chromosomeD10_02:6952833..6953043 -
D10_02chromosomeD10_02:6926156..6926369 -
CM016615.1chromosomeCM016615.1:11875495..11875702 -
CM016615.1chromosomeCM016615.1:11841496..11841709 -
Dt_chr3chromosomeDt_chr3:28622604..28622811 +
Dt_chr3chromosomeDt_chr3:28655815..28656028 +
At_chr8chromosomeAt_chr8:13178239..13178452 +
At_chr8chromosomeAt_chr8:13204077..13204290 +
D03chromosomeD03:6963820..6964027 -
D03chromosomeD03:6931793..6932006 -
A02chromosomeA02:76137753..76137966 -
A02chromosomeA02:76112201..76112414 -
Ghir_D03chromosomeGhir_D03:7051928..7052135 -
Ghir_D03chromosomeGhir_D03:7019412..7019625 -
Ghir_A02chromosomeGhir_A02:100427758..100427971 -
Ghir_A02chromosomeGhir_A02:100401932..100402145 -
D03chromosomeD03:6881243..6881450 -
D03chromosomeD03:6848516..6848729 -
A02chromosomeA02:100840712..100840925 -
A02chromosomeA02:100817154..100817367 -
D03chromosomeD03:7095088..7095295 -
D03chromosomeD03:7062561..7062774 -
A02chromosomeA02:98049859..98050072 -
A02chromosomeA02:98024024..98024237 -
D03chromosomeD03:6917307..6917514 -
D03chromosomeD03:6884774..6884987 -
A02chromosomeA02:96691654..96691867 -
A02chromosomeA02:96665819..96666032 -
scaffold6316supercontigscaffold6316:562159..562366 +
scaffold6316supercontigscaffold6316:611002..611215 +
scaffold17720supercontigscaffold17720:71741..71951 +
scaffold17720supercontigscaffold17720:99053..99266 +
Gbar_D03chromosomeGbar_D03:6932378..6932585 -
Gbar_D03chromosomeGbar_D03:6897167..6897380 -
Gbar_A02chromosomeGbar_A02:92865357..92865567 -
Gbar_A02chromosomeGbar_A02:92839609..92839822 -
D03chromosomeD03:7035099..7035306 -
D03chromosomeD03:7011753..7011966 -
A02chromosomeA02:94898429..94898639 -
A02chromosomeA02:94872874..94873087 -
CM017625.1chromosomeCM017625.1:6927878..6928085 -
CM017625.1chromosomeCM017625.1:6892672..6892885 -
CM017611.1chromosomeCM017611.1:96804905..96805112 -
CM017611.1chromosomeCM017611.1:96779059..96779272 -
CM017651.1chromosomeCM017651.1:7186000..7186207 -
CM017651.1chromosomeCM017651.1:7147209..7147422 -
CM017637.1chromosomeCM017637.1:102063008..102063215 -
CM017637.1chromosomeCM017637.1:102037194..102037407 -
CM017703.1chromosomeCM017703.1:7049452..7049659 -
CM017703.1chromosomeCM017703.1:7014166..7014379 -
CM017689.1chromosomeCM017689.1:94705182..94705392 -
CM017689.1chromosomeCM017689.1:94679424..94679637 -
Sequence
>MGHES0024 ID=MGHES0024|Name=MGHES0024|organism=Gossypium hirsutum|type=genetic_marker|length=208bp
CGCAACAACTGATGCAACTCAGCGATGAAGATAACAGCAGCAGCAGCAGC
AGCAATGGCAACAACAATAACAAGAAAATCATAGCGAAGATGATGAAAGA
CGGGAGATACTTGGAACAAAGTCAAAATGAGATAACTTCAGCAAAGATTG
AAGAAATTTTTGGGAAAGAAGAGATTTCAAGACCAACTAAGAAGCGGAGG
TATCGGTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr02N/AAD_chr.0240.1MGHES24View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr02-2N/AAD_chr.0244.4MGHES24View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr02N/AAD_chr.0269.1MGHES24View
4GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-2N/AAD_chr.0292.1MGHES24View
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-2N/AAD_chr.0292.1MGHES24View
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0241.4MGHES24View
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.0298mghes0024View
8GX1135 x GX100-2, F2 (2013)GG-F2_chr02-1N/AAD_chr.0265.2MGHE24View
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0273.9MGHES24View