JESPR0304, JESPR0304 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	JESPR0304
Alias	JESPR304
Genbank ID	AF351542
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	AF351542.1
Source Type	genomic
Repeat Motif	(GAT)8
Primer 1	JESPR0304_F: GAAATGCATTCCCTCAAAAGC
Primer 2	JESPR0304_R: AGACTCTATCGAATGACCCTG
Polymorphism	P_ JESPR0304
Publication	[view all]
Comment	Primer data obtained in 2002

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	AF351542

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
A02	chromosome	A02:88546128..88546272 +
CM018203.1	chromosome	CM018203.1:98200896..98201019 +
Chr02_CRI-A2_v1.0.a1	chromosome	Chr02_CRI-A2_v1.0.a1:1859488..1859620 -
scaffold494_A02	supercontig	scaffold494_A02:66925..67069 -
Ghir_A02	chromosome	Ghir_A02:106273763..106273907 +
A02	chromosome	A02:106498070..106498214 +
A02	chromosome	A02:103933278..103933422 +
A02	chromosome	A02:102524594..102524738 +
At02	chromosome	At02:87652820..87652943 +
scaffold9641	supercontig	scaffold9641:75528..75651 +
Gbar_A02	chromosome	Gbar_A02:98396560..98396683 +
A02	chromosome	A02:100390785..100390908 +
CM017611.1	chromosome	CM017611.1:103353790..103353919 +
CM017637.1	chromosome	CM017637.1:108017484..108017616 +
CM017689.1	chromosome	CM017689.1:100521612..100521735 +
A02	chromosome	A02:106391249..106391393 +
Chr02	chromosome	Chr02:91088553..91088676 +
Chr02	chromosome	Chr02:100743717..100743849 +
B_04	chromosome	B_04:72219466..72219592 +
F02	chromosome	F02:1544480..1544603 -
Chr02	chromosome	Chr02:137692331..137692461 +

Publications


Year	Publication
2001	Reddy O, Pepper A, Abdurakhmonov I, Saha S, Jenkins J, Brooks T, Bolek Y, El-Zik K. New dinucleotide and trinucleotide microsatellite marker resources for cotton genome research. Journal of cotton science. 2001; 5(2):103-113

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
AF351542.1	AF351542.1	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	CCRI-36 x Hai-7124, F2 (2007)	AD_ch02_At.02	N/A	15.8	JESP304	View
2	GX1135 x GX100-2, F2 (2013)	AD_ch02_At.02	N/A	34.6	JESP304	View
3	Handan-208 x Pima-90, F2:3 (2007)	AD_ch08_At.08	N/A	261.7	JESPR304	View
4	TM-1 x 3-79, RIL (2012)	AD_ch02_At.02	N/A	21.25	JESPR304	View
5	Emian-22 x 3-79, BC1 (2011)	AD_ch02_At.02	N/A	108.58	JESPR304	View
6	Yumian-1 x T586, RIL (2015)	AD_ch17_Dt.03	N/A	11	JESPR304	View
7	TM-1 x 3-79, RIL (2014)	AD_ch02_At.02	N/A	21.9	JESPR304	View
8	GX1135 x GX100-2, RIL (2015)	AD_ch02_At.02	N/A	65.8	JESPR304	View
9	GX1135 x GX100-2, RIL (2016)	AD_ch02_At.02	N/A	65.7	JESPR304	View
10	GX1135 x VGX100-2, RIL (2016)	AD_ch02_At.02	N/A	105.7	JESPR304	View
11	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch02_At.02	N/A	129.3	JESPR304	View
12	Monsanto SSR Bin Map, (2009)	AD_ch02_At.02	N/A	21	JESPR304	View
13	AD-genome wide Reference Map (2009)	AD_ch02_At.02	N/A	18	jespr0304	View
14	TM-1 x Hai-7124, BC1 (2008)	AD_ch02_At.02	N/A	88.19	JESPR304-130	View
15	TM-1 x Hai-7124, BC1 (2012)	AD_ch02_At.02	N/A	86.6	JESPR304-130	View
16	TM-1 x Hai-7124, BC1 (2008)	AD_ch17_Dt.03	N/A	73.61	JESPR304-140	View
17	TM-1 x Hai-7124, BC1 (2012)	AD_ch17_Dt.03	N/A	26.6	JESPR304-140	View
18	0-153 x sGK9708, RIL (2016)	AD_ch02_At.02	N/A	3.2	JESPR304a	View
19	0-153 x sGK9708, RIL (2016)	AD_ch17_Dt.03	N/A	36.2	JESPR304b	View
20	TM-1 x 3-79, RIL (2012.v3)	AD_ch02_At.02	N/A	21.86	JESPR304	View

Sequence

>JESPR0304 ID=JESPR0304; Name=JESPR0304; organism=Gossypium hirsutum; type=genetic_marker; length=145bp
GAAATGCATTCCCTCAAAAGCCCNAACCCAAAAAAGAAATTCTATTAGGT
CCTTAGTGAATTCCACTATCAATGAACAGATGAATGATGATGATGATGAT
GATGAAGAANATGATGATATTATACAGGGTCATTCGATAGAGTCT

Search form

JESPR0304, JESPR0304 (genetic_marker) Gossypium hirsutum