JESPR0197, JESPR0197 (genetic_marker) Gossypium hirsutum

Marker Overview
NameJESPR0197
AliasJESPR197
Genbank IDAF351435
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceAF351435.1
Source Typegenomic
Repeat Motif(TAC)11
Primer 1JESPR0197_F: CAATACCTGGAACATAGACAAATG
Primer 2JESPR0197_R: CTTGAGGCTTGCAAAAAATG
PolymorphismP_ JESPR0197
Publication[view all]
CommentPrimer data obtained in 2002
Germplasm
Stock NameType
Tamcot Sphinxcultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF351435
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
JESPR0197_FJESPR0197_FGossypium hirsutumprimer
JESPR0197_RJESPR0197_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
JESPR197JESPR197Gossypium hirsutummarker_locus
jespr0197jespr0197Gossypium hirsutummarker_locus
JESPR197-205JESPR197-205Gossypium hirsutummarker_locus
JESPR197-105JESPR197-105Gossypium hirsutummarker_locus
JESPR197/85y(C5)JESPR197/85y(C5)Gossypium hirsutummarker_locus
JESPR197JESPR197-141.891Gossypium hirsutummarker_locus
JESPR197JESPR197-112.987Gossypium hirsutummarker_locus
JESPR197JESPR197-146.4Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AF351435.1AF351435.1Gossypium hirsutumsequence_feature


Sequence
>JESPR0197 ID=JESPR0197|Name=JESPR0197|organism=Gossypium hirsutum|type=genetic_marker|length=93bp
CAATACCTGGAACATAGACAAATGTAAGTAAATACTACTACTACTACTAC
TACTACTACTACTACAAACCGTGCATTTTTTGCAAGCCTCAAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr05N/AAD_chr.05151.96JESPR197
2Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr05N/AAD_chr.05110JESPR197
3Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr05N/AAD_chr.0548.9JESPR197
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.0589.47JESPR197
5Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.2N/AAD_chr.0528.4JESPR197
6Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.0562JESPR197
7Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-2N/AAD_chr.0528.4JESPR197
8Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0576.9JESPR197
9Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0574.6JESPR197
10TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.05113JESPR197
11W10 x TM-1, F2:3 (2015)WT-F2:3_chr05-1N/AAD_chr.0543.9JESPR197
12CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr21N/AAD_chr.21150.4JESPR197
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05165jespr0197
14TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.05110.4JESPR197-205
15TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.0597.82JESPR197-205
16Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr05N/AAD_chr.0520JESPR197-105
17Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.0562JESPR197/85y(C5)
18CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.05141.89JESPR197
19TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.05112.99JESPR197
20MGG-293-793, MAGIC (2018)MAGIC-19831_chr02N/AAD_chr.02146.4JESPR197
21MGG-293-793, MAGIC (2018)MAGIC-19831_chr05N/AAD_chr.05146.4JESPR197