JESPR0152, JESPR0152 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	JESPR0152
Alias	JESPR152
Genbank ID	AF351390
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	AF351390.1
Source Type	genomic
Repeat Motif	(GAA)50
Primer 1	JESPR0152_F: GATGCACCAGATCCTTTTATTAG
Primer 2	JESPR0152_R: GGTACATCGGAATCACAGTG
Polymorphism	P_ JESPR0152
Publication	[view all]
Comment	Primer data obtained in 2002

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	AF351390

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
D01	chromosome	D01:62160134..62160369 -
CM018215.1	chromosome	CM018215.1:60611064..60611269 -
scaffold238.1	supercontig	scaffold238.1:1447946..1448279 -
D01	chromosome	D01:59289789..59290090 -
Ghir_D01	chromosome	Ghir_D01:61005632..61005867 -
D01	chromosome	D01:59209923..59210152 -
scaffold5640	supercontig	scaffold5640:68368..68957 +
scaffold2165	supercontig	scaffold2165:93500..93606 +
Gbar_D01	chromosome	Gbar_D01:60860031..60860212 -
D01	chromosome	D01:61504365..61504570 -
CM017649.1	chromosome	CM017649.1:63291532..63291698 -
CM017701.1	chromosome	CM017701.1:61264032..61264255 -
D01	chromosome	D01:62905427..62905662 -

Publications


Year	Publication
2001	Reddy O, Pepper A, Abdurakhmonov I, Saha S, Jenkins J, Brooks T, Bolek Y, El-Zik K. New dinucleotide and trinucleotide microsatellite marker resources for cotton genome research. Journal of cotton science. 2001; 5(2):103-113

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
AF351390.1	AF351390.1	Gossypium hirsutum	sequence_feature

Image


File Name	Legend
48_FISH_TAG-115-675.jpg	Twenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Deltapine-61 x Texas-701, F2 (2007)	AD_ch15_Dt.01	N/A	57.7	JESPR152-203	View
2	Guazuncho-2 x VH8-4602, BC1 (2005)	AD_ch15_Dt.01	N/A	19	JESPR152	View
3	Guazuncho-2 x VH8-4602, consensus (2009)	AD_ch15_Dt.01	N/A	23.78	JESPR152	View
4	TM-1 x 3-79, RIL (2012)	AD_ch15_Dt.01	N/A	100.42	JESPR152	View
5	TM-1 x 3-79, RIL (2014)	AD_ch15_Dt.01	N/A	19.5	JESPR152	View
6	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch15_Dt.01	N/A	40.3	JESPR152	View
7	Monsanto SSR Bin Map, (2009)	AD_ch15_Dt.01	N/A	0	JESPR152	View
8	Handan-208 x Pima-90, F2:3 (2007)	AD_ch10_At.10	N/A	64.2	JESPR152a*	View
9	Handan-208 x Pima-90, F2:3 (2007)	AD_ch15_Dt.01	N/A	4.4	JESPR152b*	View
10	AD-genome wide Reference Map (2009)	AD_ch10_At.10	N/A	21	jespr0152	View
11	AD-genome wide Reference Map (2009)	AD_ch15_Dt.01	N/A	26	jespr0152	View
12	Vsg x (TM-1 x Hai-7124), DH (2005)	AD_ch15_Dt.01	N/A	17	JESPR152-230	View
13	TM-1 x Hai-7124, BC1 (2007)	AD_ch15_Dt.01	N/A	106.7	JESPR152-230	View
14	TM-1 x Hai-7124, BC1 (2008)	AD_ch15_Dt.01	N/A	104.91	JESPR152-230	View
15	TM-1 x Hai-7124, BC1 (2005.v0)	AD_ch15_Dt.01	N/A	0	JESPR152-230	View
16	TM-1 x Hai-7124, BC1 (2012)	AD_ch15_Dt.01	N/A	17.3	JESPR152-230	View
17	TM-1 x 3-79, RIL (2012.v3)	AD_ch15_Dt.01	N/A	19.48	JESPR152	View
18	PD 94042 x (AD)4-08, F2 (2016)	AD_ch15_Dt.01	N/A	196.7	JESPR152	View

Sequence

>JESPR0152 ID=JESPR0152; Name=JESPR0152; organism=Gossypium hirsutum; type=genetic_marker; length=233bp
GATGCACCAGATCCTTTTATTAGTTTATAAGGATTACCAACTAAATAGAA
GAAGAAGAAGAAGAGGAAGAAGAAGAAGAAAAGGAAGAAGAAGAAGAAGA
ATAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAAAGAG
AAATGGAAATACCCACTGTGATTCCGATGTACC

Search form

JESPR0152, JESPR0152 (genetic_marker) Gossypium hirsutum