JESPR0055, JESPR0055 (genetic_marker) Gossypium hirsutum

Marker Overview
NameJESPR0055
AliasJESPR055
Genbank IDAF351294
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceAF351294.1
Source Typegenomic
Repeat Motif(CT)6A(CA)11
Primer 1JESPR0055_F: GTTCGAGGAGGATTGAGGTAGAGGA
Primer 2JESPR0055_R: CCCCTTCTCTTGCTTAGATCTGGAC
Publication[view all]
CommentPrimer data obtained in 2002
Germplasm
Stock NameType
Tamcot Sphinxcultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF351294
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
JESPR0055_FJESPR0055_FGossypium hirsutumprimer
JESPR0055_RJESPR0055_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
jespr0055jespr0055Gossypium hirsutummarker_locus
JESPR55JESPR55Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AF351294.1AF351294.1Gossypium hirsutumsequence_feature


Sequence
>JESPR0055 ID=JESPR0055|Name=JESPR0055|organism=Gossypium hirsutum|type=genetic_marker|length=231bp
GTTCGAGGAGGATTGAGGTAGAGGAGCTTTTGCCGTATGCGCATGGATAC
ACCGAGCTAAATTTTTTCTAAAGGAGGTTACGACCTGCATTCAATGTATC
CTCTCTCTCTCTACACACACACACACACACACACACGTGAATGCCTATTT
ATATTTGCAAATATTTGTTTTTTTTAACCATTACTTAAGTGATTCCTATT
GTTTTAGTCCAGATCTAAGCAAGAGAAGGGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05125jespr0055
2Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.2N/AAD_chr.0536.1JESPR55
3Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-2N/AAD_chr.0536.1JESPR55