JESPR0019, JESPR0019 (genetic_marker) Gossypium hirsutum

Marker Overview
NameJESPR0019
AliasJESPR019
Genbank IDAF351261
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceAF351261.1
Source Typegenomic
Repeat Motif(GAA)20
Primer 1JESPR0019_F: GAATTCTAATGTTTATAAAAAAATA
Primer 2JESPR0019_R: CTATATAAAGTATCAGAGAAATTC
Publication[view all]
CommentPrimer data obtained in 2002
Germplasm
Stock NameType
Tamcot Sphinxcultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF351261
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
JESPR0019_FJESPR0019_FGossypium hirsutumprimer
JESPR0019_RJESPR0019_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
JESPR19-190JESPR19-190Gossypium hirsutummarker_locus
JESPR019JESPR019Gossypium hirsutummarker_locus
JESPR019JESPR019-58.433Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AF351261.1AF351261.1Gossypium hirsutumsequence_feature


Sequence
>JESPR0019 ID=JESPR0019|Name=JESPR0019|organism=Gossypium hirsutum|type=genetic_marker|length=182bp
GAATTCTAATGTTTATAAAAAAATAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGATAATATAGTCAT
ATTCAGTATCCATACCAATGGGTAAAGTGGAGCACAATCGAAGCTTGAAT
CGTGATTTGAATTTCTCTGATACTTTATATAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.12.1N/AAD_chr.1226.3JESPR19-190
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr12N/AAD_chr.1261.1JESPR019
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr12N/AAD_chr.12148.7JESPR019
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr12N/AAD_chr.1241.4JESPR019
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr12N/AAt.1258.43JESPR019