HAU2489, HAU2489 (genetic_marker) gossypium spp

Marker Overview
NameHAU2489
Genbank IDES819162
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(GT)9
PCR ConditionAnnealing temperature: 55.0
Primer 1HAU2489_F: GGCACGAGGAGAAAATGAAAGA
Primer 2HAU2489_R: GATCGGATTCTGGGTCCCGC
Product Length305
Publication[view all]
CommentPrimer data obtained in 2012
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankES828537
DB:genbankES819162
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.YCY7-4WC_chr15-2.bb08.2Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2489_FHAU2489_FGossypium spp.primer
HAU2489_RHAU2489_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2489HAU2489Gossypium spp.marker_locus
HAU2489HAU2489-15.558Gossypium spp.marker_locus
HAU2489HAU2489-44.8Gossypium spp.marker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A01chromosomeA01:2771997..2772294 -
A01chromosomeA01:2899527..2899831 -
CM018215.1chromosomeCM018215.1:2162829..2163121 -
CM018202.1chromosomeCM018202.1:2252910..2253209 -
D5_01chromosomeD5_01:2060389..2060689 -
KI_01chromosomeKI_01:2047888..2048181 -
Chr7chromosomeChr7:107530623..107530925 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:2237328..2237630 -
Chr8chromosomeChr8:62272623..62272923 +
D10_01chromosomeD10_01:58453146..58453450 +
scaffold1463.1supercontigscaffold1463.1:359743..360031 +
scaffold3708_D01supercontigscaffold3708_D01:68480..68784 -
A01chromosomeA01:1986283..1986587 -
Ghir_D01chromosomeGhir_D01:2208491..2208794 -
Ghir_A01chromosomeGhir_A01:2504977..2505272 -
D01chromosomeD01:2106320..2106624 -
A01chromosomeA01:2423522..2423819 -
D01chromosomeD01:2203039..2203327 -
A01chromosomeA01:2541296..2541593 -
D01chromosomeD01:2000378..2000666 -
A01chromosomeA01:2493190..2493487 -
scaffold13465supercontigscaffold13465:31490..31789 +
scaffold7906supercontigscaffold7906:176113..176405 -
Gbar_D01chromosomeGbar_D01:2251421..2251713 -
Gbar_A01chromosomeGbar_A01:2224238..2224537 -
D01chromosomeD01:2156290..2156582 -
A01chromosomeA01:2227030..2227329 -
CM017623.1chromosomeCM017623.1:2265654..2265961 -
CM017610.1chromosomeCM017610.1:2750029..2750325 -
CM017649.1chromosomeCM017649.1:2090858..2091152 -
CM017636.1chromosomeCM017636.1:2282385..2282685 -
CM017701.1chromosomeCM017701.1:2405187..2405479 -
CM017688.1chromosomeCM017688.1:2343490..2343789 -
Sequence
>HAU2489 ID=HAU2489|Name=HAU2489|organism=Gossypium spp.|type=genetic_marker|length=305bp
GGCACGAGGAGAAAATGAAAGAAAGTGAGAGAAAGTGAAAGAAAATTTAG
ACAAAAAACCAAACTGAACCCAGAAAAAACAGCAGACAAAACAGTGTGTG
TGTGTGTGTGTTTTTCTGGTTCAGTGTAAGAAAGAAAGACAAGAGACATA
GAGAGAATTTCTGGGTTTTTTTGTGTCCTTTTTTTTTGTTCTTCGTTTTC
CATCTAGAAAAAGAGATATATTTAGCCATTTGATCGGATTACAGTTAGGG
TTTACTTGGGGGTTGTTGTTTGTACGTTAAATGGAGCGGGACCCAGAATC
CGATC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.1533.99HAU2489View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr15-2N/AAD_chr.15171.8HAU2489View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.1514.2HAU2489View
4GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr01N/AAD_chr.01182.9HAU2489View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0115.56HAU2489View
6MGG-293-793, MAGIC (2018)MAGIC-19831_chr15N/AAD_chr.1544.8HAU2489View