HAU1001, HAU1001 (genetic_marker) gossypium spp

Marker Overview
NameHAU1001
AliasTA23806_3635
Genbank IDN/A
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(CAGCTT)6
PCR ConditionAnnealing temperature: 56.9
Primer 1HAU1001_F: ACAGGATGTGCATGTTATGG
Primer 2HAU1001_R: ATCTCTTGATTTGGGGTCAA
Product Length292
Publication[view all]
CommentPrimer data obtained in 2012
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU1001_FHAU1001_FGossypium spp.primer
HAU1001_RHAU1001_RGossypium spp.primer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed protein contentqSPC.YT-RIL_ch01.cq07Gossypium hirsutumQTL
fiber elongationqFEL.DJiM-RIL_ch01.h11.2Gossypium hirsutumQTL
fiber elongationqFEL.DJiM-RIL_ch15.h11.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU1001HAU1001Gossypium spp.marker_locus
HAU1001aHAU1001aGossypium spp.marker_locus
HAU1001bHAU1001bGossypium spp.marker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:5156023..5156302 -
A01chromosomeA01:7558075..7558360 -
CM018215.1chromosomeCM018215.1:5730078..5730375 -
CM018202.1chromosomeCM018202.1:6833181..6833466 -
D5_01chromosomeD5_01:5447119..5447398 -
KI_01chromosomeKI_01:4488061..4488334 -
Chr7chromosomeChr7:115885952..115886231 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:7772310..7772589 -
Chr4chromosomeChr4:7847249..7847528 +
D10_01chromosomeD10_01:54931054..54931333 +
CM016614.1chromosomeCM016614.1:8275741..8276020 -
At_chr2chromosomeAt_chr2:6842992..6843277 -
At_chr2chromosomeAt_chr2:7203579..7203858 -
D01chromosomeD01:4848794..4849073 -
A01chromosomeA01:6404290..6404575 -
Ghir_D01chromosomeGhir_D01:6044677..6044956 -
Ghir_A01chromosomeGhir_A01:6895307..6895592 -
D01chromosomeD01:5702095..5702374 -
A01chromosomeA01:6540101..6540386 -
A01chromosomeA01:6884677..6884962 -
D01chromosomeD01:5903232..5903511 -
A01chromosomeA01:6831863..6832148 -
Dt01chromosomeDt01:4571346..4571637 -
Dt01chromosomeDt01:4569148..4569433 -
scaffold12512supercontigscaffold12512:32992..33595 +
scaffold12512supercontigscaffold12512:35154..35439 +
scaffold10110supercontigscaffold10110:87629..87920 -
scaffold10110supercontigscaffold10110:85431..85716 -
Gbar_D01chromosomeGbar_D01:6347365..6347662 -
Gbar_A01chromosomeGbar_A01:6796431..6796716 -
D01chromosomeD01:6114690..6114987 -
A01chromosomeA01:6527084..6527369 -
CM017623.1chromosomeCM017623.1:5875116..5875407 -
CM017610.1chromosomeCM017610.1:7801891..7802176 -
CM017649.1chromosomeCM017649.1:6602462..6602753 -
CM017636.1chromosomeCM017636.1:6805859..6806144 -
CM017701.1chromosomeCM017701.1:6010190..6010481 -
CM017688.1chromosomeCM017688.1:6929139..6929424 -
Sequence
>HAU1001 ID=HAU1001|Name=HAU1001|organism=Gossypium spp.|type=genetic_marker|length=292bp
ACAGGATGTGCATGTTATGGCAGATACATTGTCAGGGCTATTTGAAGAAA
AATGGGCAGCTATAGAGTCTGAGTCTAACCTTAATAGGAGGTTCGAAAGG
AGTCATGATTACAATTTGCCAACTCCCACTTCAAGGAGAATTCCAGCTTC
AGCTCCAGCTCCAGCTCCAGCTTCAGCACCAATTCAATCTCATGGCCCTC
CTGCTTTAGCTCATTCATCACTACCATTAGAAGCTAGGACTCTTGAGAGG
TCAGAATCCATGACAATGCCTGTTGACCCCAAATCAAGAGAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.1543.65HAU1001
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.017.5HAU1001
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0131.7HAU1001
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.0172.4HAU1001
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0153.64HAU1001
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1553.64HAU1001
7GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-2N/AAD_chr.019.4HAU1001
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0168.1HAU1001
9DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1568.1HAU1001
10CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.01128.2HAU1001
110-153 x sGK9708, RIL (2016)0s-RIL_chr01-2N/AAD_chr.012.1HAU1001a
120-153 x sGK9708, RIL (2016)0s-RIL_chr01-2N/AAD_chr.015.2HAU1001b