HAU0952, HAU0952 (genetic_marker) gossypium spp

Marker Overview
NameHAU0952
AliasTA22312_3635
Genbank IDN/A
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(AAG)6
PCR ConditionAnnealing temperature: 57.3
Primer 1HAU0952_F: CCAGCCAAATGTAGTGTCAA
Primer 2HAU0952_R: AAATTCCATCCCAAAATCCT
Product Length168
Publication[view all]
CommentPrimer data obtained in 2012
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU0952_FHAU0952_FGossypium spp.primer
HAU0952_RHAU0952_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU952HAU952Gossypium spp.marker_locus
HAU0952HAU0952Gossypium spp.marker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:4528911..4529197 -
A02chromosomeA02:3281701..3281991 -
CM018216.1chromosomeCM018216.1:3905638..3905928 -
CM018203.1chromosomeCM018203.1:3322111..3322398 -
D5_03chromosomeD5_03:59818303..59818593 +
KI_03chromosomeKI_03:2763858..2764145 -
Chr5chromosomeChr5:56831724..56832017 -
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:3648380..3648673 -
Chr5chromosomeChr5:1501795..1502085 +
D10_03chromosomeD10_03:64889672..64889962 -
CM016616.1chromosomeCM016616.1:148334361..148334654 +
At_chr9chromosomeAt_chr9:4029604..4029891 +
scaffold189.1supercontigscaffold189.1:539313..539599 -
scaffold112574supercontigscaffold112574:24..310 -
D02chromosomeD02:4483776..4484062 -
A02chromosomeA02:3176932..3177222 -
Ghir_D02chromosomeGhir_D02:4317599..4317885 -
Ghir_A02chromosomeGhir_A02:3320489..3320779 -
D02chromosomeD02:4120615..4120901 -
A02chromosomeA02:3178653..3178943 -
D02chromosomeD02:4337472..4337758 -
A02chromosomeA02:3437898..3438185 -
D02chromosomeD02:4258186..4258472 -
A02chromosomeA02:3310504..3310794 -
Dt02chromosomeDt02:3154456..3154746 -
scaffold9852supercontigscaffold9852:113365..113652 +
scaffold2354supercontigscaffold2354:574261..574551 -
Gbar_D02chromosomeGbar_D02:4409848..4410138 -
Gbar_A02chromosomeGbar_A02:3257081..3257368 -
D02chromosomeD02:4087661..4087950 -
A02chromosomeA02:3255141..3255428 -
CM017624.1chromosomeCM017624.1:4713333..4713618 -
CM017611.1chromosomeCM017611.1:3327805..3328101 -
CM017650.1chromosomeCM017650.1:4937337..4937622 -
CM017637.1chromosomeCM017637.1:3366649..3366935 -
CM017702.1chromosomeCM017702.1:4352065..4352355 -
CM017689.1chromosomeCM017689.1:3328600..3328887 -
Sequence
>HAU0952 ID=HAU0952|Name=HAU0952|organism=Gossypium spp.|type=genetic_marker|length=168bp
CCAGCCAAATGTAGTGTCAACATCCCTTACAAGATCAGCACTTCCACTAA
CTGCAAAAATGTGAAGTGAGATGGATGAAGAGAGGGTTTTGCAGCAGCTT
GCAGGAGATAAAATATATGATTAAAAAGAAGAAGAAGAAGAATGAATAAG
GATTTTGGGATGGAATTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.0270.5HAU952View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr14N/ADt.0231.1HAU0952View