HAU0030, HAU0030 (genetic_marker) Gossypium barbadense

Marker Overview
NameHAU0030
AliasHAU030
Genbank IDEE593197
TypeSSR
SpeciesGossypium barbadense
Germplasm3-79
Source TypeEST
Repeat Motif(AG)5
Primer 1HAU0030_F: CGAAGACAAAGAAACACAGAGC
Primer 2HAU0030_R: AGATCGCAAAAATGAAGAGC
Product Length165
Publication[view all]
ContactZhang, Xian-Long
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
3-79cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankEE593197
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU0030_FHAU0030_FGossypium barbadenseprimer
HAU0030_RHAU0030_RGossypium barbadenseprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU030aHAU030aGossypium barbadensemarker_locus
HAU030bHAU030bGossypium barbadensemarker_locus
HAU030/1200yHAU030/1200yGossypium barbadensemarker_locus
HAU030/500tHAU030/500tGossypium barbadensemarker_locus
HAU0030aHAU0030aGossypium barbadensemarker_locus
HAU0030bHAU0030bGossypium barbadensemarker_locus


Contact
NameDetails
Zhang, Xian-Long
Description:Genomics breeding
First name:Xian-Long
Last name:Zhang
Title:Professor
Institution:College of Plant Science and Technology, Huazhong Agricultural University
Address:#1 Shizishan, Wuhan, Hubei 430070
Country:China
Email:xlzhang@mail.hzau.edu.cn
Phone:+86 27 87280510
Fax:+86 27 87280016
Last update:12-Jun-2009
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D13chromosomeD13:49883477..49883641 +
A13chromosomeA13:87654323..87654487 +
CM018227.1chromosomeCM018227.1:45955774..45955938 +
CM018214.1chromosomeCM018214.1:91792928..91793084 +
D5_13chromosomeD5_13:44725264..44725428 +
KI_13chromosomeKI_13:33698073..33698236 +
Chr13chromosomeChr13:90542486..90542650 +
Chr13_CRI-A2_v1.0.a1chromosomeChr13_CRI-A2_v1.0.a1:105831961..105832125 +
Chr7chromosomeChr7:16426123..16426287 -
D10_13chromosomeD10_13:46870829..46870993 +
CM016626.1chromosomeCM016626.1:134383546..134383710 +
Dt_chr13chromosomeDt_chr13:18436385..18436549 -
D13chromosomeD13:45672624..45672788 +
A13chromosomeA13:64217411..64217575 +
Ghir_D13chromosomeGhir_D13:48931289..48931453 +
Ghir_A13chromosomeGhir_A13:91160960..91161124 +
D13chromosomeD13:50136056..50136220 +
A13chromosomeA13:94103637..94103801 +
D13chromosomeD13:49096401..49096565 +
A13chromosomeA13:92139424..92139588 +
D13chromosomeD13:46029489..46029653 +
A13chromosomeA13:90926042..90926206 +
At13chromosomeAt13:69489408..69489564 +
scaffold3990supercontigscaffold3990:287522..287678 +
Gbar_D13chromosomeGbar_D13:45681052..45681216 +
Gbar_A13chromosomeGbar_A13:92824866..92825022 -
D13chromosomeD13:47020053..47020217 +
A13chromosomeA13:96040917..96041073 +
CM017635.1chromosomeCM017635.1:46849858..46850022 +
CM017622.1chromosomeCM017622.1:93509997..93510161 +
CM017661.1chromosomeCM017661.1:49990555..49990719 +
CM017648.1chromosomeCM017648.1:98501643..98501807 +
CM017713.1chromosomeCM017713.1:46997318..46997482 +
CM017700.1chromosomeCM017700.1:93941557..93941721 +
Sequence
>HAU0030 ID=HAU0030|Name=HAU0030|organism=Gossypium barbadense|type=genetic_marker|length=165bp
CGAAGACAAAGAAACACAGAGCAGAGAGAGAGACTAAGGGTGAAAATGGC
CTGGTGTAGTTTAAGGTCTATTCACGTTCCAACCGTCGATGTCGGATTAC
TACGCACTCGCTCCCCGTTAGCCGCTGTCGGTGGAGTCGTTGCCGGCTCT
TCATTTTTGCGATCT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr01-2N/AAD_chr.0132.9HAU030a
2Yumian-1 x T586, RIL (2006)YT-RIL_chr08-3N/AAD_chr.080HAU030b
3Yumian-1 x T586, RIL (2009)YT-RIL_chr01-2N/AAD_chr.0141.3HAU030/1200y
4Yumian-1 x T586, RIL (2009)YT-RIL_chr08-2N/AAD_chr.0835.6HAU030/500t
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr08N/AAD_chr.0859.9HAU0030a
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0152HAU0030b