DPL0526, DPL0526 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDPL0526
Genbank IDGQ395040
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceGQ395040
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0526_F: GTTCTTGGTCATGCTGGTAAGAAA
Primer 2DPL0526_R: TAGCCATATCCACCTTAGCAGATT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Delta Opalcultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0526_FDPL0526_FGossypium hirsutumprimer
DPL0526_RDPL0526_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.CY-RIL_ch01.swu11Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0526DPL0526Gossypium hirsutummarker_locus
MON_DPL0526MON_DPL0526Gossypium hirsutummarker_locus
MON-DPL0526MON-DPL0526Gossypium hirsutummarker_locus
DPL0526DPL0526-89.126Gossypium hirsutummarker_locus
DPL0526DPL0526-24.675Gossypium hirsutummarker_locus
DPL0526DPL0526-12.6Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ395040GQ395040Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:63463754..63463897 +
A01chromosomeA01:102937787..102937942 +
CM018215.1chromosomeCM018215.1:61832342..61832485 +
CM018202.1chromosomeCM018202.1:112004399..112004538 +
D5_01chromosomeD5_01:55709484..55709631 +
KI_01chromosomeKI_01:37301306..37301445 +
Chr2chromosomeChr2:69515199..69515358 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:98326264..98326423 +
Chr2chromosomeChr2:926783..926918 -
D10_01chromosomeD10_01:881693..881852 -
CM016614.1chromosomeCM016614.1:136115311..136115446 +
At_chr9chromosomeAt_chr9:41400644..41400799 +
scaffold3227.1supercontigscaffold3227.1:112802..112945 -
D01chromosomeD01:60552332..60552475 +
A01chromosomeA01:98936697..98936852 +
Ghir_D01chromosomeGhir_D01:62263644..62263787 +
Ghir_A01chromosomeGhir_A01:116677326..116677481 +
D01chromosomeD01:63719048..63719191 +
A01chromosomeA01:117023100..117023255 +
D01chromosomeD01:63695663..63695806 +
A01chromosomeA01:114936645..114936800 +
D01chromosomeD01:60163447..60163590 +
A01chromosomeA01:111526485..111526644 +
scaffold15606supercontigscaffold15606:28273..28412 -
Gbar_D01chromosomeGbar_D01:62002208..62002351 +
Gbar_A01chromosomeGbar_A01:114529741..114529880 +
D01chromosomeD01:62681889..62682032 +
A01chromosomeA01:114529022..114529161 +
CM017623.1chromosomeCM017623.1:63019504..63019659 +
CM017610.1chromosomeCM017610.1:113059583..113059738 +
CM017649.1chromosomeCM017649.1:64538711..64538854 +
CM017636.1chromosomeCM017636.1:120610014..120610169 +
CM017701.1chromosomeCM017701.1:62490505..62490648 +
CM017688.1chromosomeCM017688.1:110679673..110679820 +
Chr2chromosomeDPL0526:1..587 .
Chr2:926432..926998 -
Chr02chromosomeDPL0526:1..587 .
Chr02:61837773..61838339 +
Sequence
>DPL0526 ID=DPL0526|Name=DPL0526|organism=Gossypium hirsutum|type=genetic_marker|length=156bp
GTTCTTGGTCATGCTGGTAAGAAAAAAACGTATGCATGTATGTATGTATA
TACATATGTATGTATGTATGTATGTATGTATTGATATTTGGACGTTTGTG
TATAGATGGAATTTGCCATGTTTATGTGGACAAATCTGCTAAGGTGGATA
TGGCTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.0110DPL0526View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.01119.7DPL0526View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.011.4DPL0526View
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.0124.7DPL0526View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.0132DPL0526View
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.01139.7MON_DPL0526View
7W10 x TM-1, F2:3 (2015)WT-F2:3_chr01-2N/AAD_chr.010MON-DPL0526View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0189.13DPL0526-89.126View
9TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.0124.68DPL0526-24.675View
10MGG-293-793, MAGIC (2018)MAGIC-19831_chr01N/AAD_chr.0112.6DPL0526-12.6View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ395040