DPL0513, DPL0513 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDPL0513
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0513_orig
Source Typegenomic
Repeat Motif(GTAT)21
PCR ConditionAnnealing temperature: 55
Primer 1DPL0513_F: AGACCCGGCTACTACATGTTATCTT
Primer 2DPL0513_R: ACATACAGATGCTTCACACAAACAC
PolymorphismP_ DPL0513
ContactFang, David D.
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Delta Opalcultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0513_FDPL0513_FGossypium hirsutumprimer
DPL0513_RDPL0513_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0513DPL0513Gossypium hirsutummarker_locus
DPL0513/200yDPL0513/200yGossypium hirsutummarker_locus
DPL0513DPL0513-87.453Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0513_origDPL0513_origGossypium hirsutumsequence_feature


Contact
NameDetails
Fang, David D.
Description:Molecular markers, fiber development
First name:David
Last name:Fang
Title:Supervisory Research Geneticist
Institution:USDA-ARS-SRRC-CFBRU
Address:1100 Robert E. Lee Blvd, New Orleans, LA 70124
Country:United States
Email:david.fang@usda.gov
Phone:504 286 4527
Fax:001662686-5218
Keywords:Structural Genomics
Last update:2-Jul-2009
Sequence
>DPL0513 ID=DPL0513|Name=DPL0513|organism=Gossypium hirsutum|type=genetic_marker|length=202bp
AGACCCGGCTACTACATGTTATCTTATAATGATTCCTTGTATGGTTGATG
TCTATATAGATAAAAAATATAATCTTGAGGAGTTGCAGTATGTATGTATG
TATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTA
TGTATGTATGTATGTATGTATGTTTATGTGTTTGTGTGAAGCATCTGTAT
GT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0128.36DPL0513
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0190DPL0513
3TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.0156.92DPL0513
4Yumian-1 x T586, RIL (2006)YT-RIL_chr01-2N/AAD_chr.0118.3DPL0513
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0143.5DPL0513
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.0139.5DPL0513
7TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.0187.5DPL0513
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.01100.3DPL0513
9Yumian-1 x T586, RIL (2009)YT-RIL_chr01-2N/AAD_chr.0121.8DPL0513/200y
10TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.0187.45DPL0513