DPL0346, DPL0346 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDPL0346
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0346_orig
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0346_F: AGTGAACAGGGCGGAAATATAAAG
Primer 2DPL0346_R: CTATTACTTGTCCATTCCTCTGCC
PolymorphismP_ DPL0346
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Delta Opalcultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0346_FDPL0346_FGossypium hirsutumprimer
DPL0346_RDPL0346_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0346_origDPL0346_origGossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0346DPL0346Gossypium hirsutummarker_locus
MON_DPL0346MON_DPL0346Gossypium hirsutummarker_locus
MON-DPL0346MON-DPL0346Gossypium hirsutummarker_locus
DPL0346DPL0346-79.579Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Sequence
>DPL0346 ID=DPL0346|Name=DPL0346|organism=Gossypium hirsutum|type=genetic_marker|length=225bp
AGTGAACAGGGCGGAAATATAAAGGCCGGGGAGGCTCCTTATGACGTGGG
GATTTTGGGTGGGATGGGTTTTTGGAGTAAACTATTCTTCTTCTTCTTCT
GCTGCTGCTGCTGCTGCTGCTGCTGCTCTTACATTTATCGCTGCTAAAAT
GTAAACCTTTATTGTGTAAGGTGTGAGGGAAGGAGGTAAGCTAAATAAAA
GGGCAGAGGAATGGACAAGTAATAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0177.2DPL0346View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.019.4DPL0346View
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.0140.2DPL0346View
4CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.0143.1DPL0346View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.0163.3DPL0346View
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.01117.4MON_DPL0346View
7W10 x TM-1, F2:3 (2015)WT-F2:3_chr01-1N/AAD_chr.010MON-DPL0346View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0179.58DPL0346-79.579View