DPL0217, DPL0217 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDPL0217
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0217_orig
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0217_F: TAGGGCACAGGGTGATGGT
Primer 2DPL0217_R: TGAAATCCGCAAGTGTTTCAC
PolymorphismP_ DPL0217
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Delta Opalcultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0217_FDPL0217_FGossypium hirsutumprimer
DPL0217_RDPL0217_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.GG-RIL.16_ch02-1.hd12Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-RIL.16_ch02-1.wh15Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0217_origDPL0217_origGossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL217DPL217Gossypium hirsutummarker_locus
DPL0217DPL0217Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Sequence
>DPL0217 ID=DPL0217|Name=DPL0217|organism=Gossypium hirsutum|type=genetic_marker|length=240bp
TAGGGCACAGGGTGATGGTGTGGGGACATATTGGGGTCTTTGTCTTTAGT
TTTTTTTGTTTTGTTTGTAGAGTGGTTTCTAGTATTTTGGGTCAGACTCC
ATATTTAATAGATGATATGGAAATGGATGATGATGATGATGATGGTGATG
ATGATGATGATGATAGCTAGCTATAGCTATTCTAATAAAAGTATGGTGGA
ACATAAAATAAAGAAATTAGTGAAACACTTGCGGATTTCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1GX1135 x GX100-2, F2 (2013)GG-F2_chr02-2N/AAD_chr.0229.7DPL217
2GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-1N/AAD_chr.025.4DPL0217
3GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-1N/AAD_chr.025.3DPL0217
4GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr02-1N/AAD_chr.020DPL0217