DPL0095, DPL0095 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDPL0095
AliasDPL095
Genbank IDGQ394846
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Delta Opal
Source SequenceGQ394846
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0095_F: ATTGATGACCTGTAGATGACGATG
Primer 2DPL0095_R: GTTTGCTTGCAGTATAAGATGGTG
PolymorphismP_ DPL0095
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Delta Opalcultivar
Delta Opalcultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394846
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0095_FDPL0095_FGossypium hirsutumprimer
DPL0095_RDPL0095_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.BT-F2:3_chr03.2010Gossypium hirsutumQTL
lint percentqLP.BT-F2:3_chr03.2011Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0095bDPL0095bGossypium hirsutummarker_locus
DPL0095aDPL0095aGossypium hirsutummarker_locus
MON_DPL0095MON_DPL0095Gossypium hirsutummarker_locus
DPL0095DPL0095-61.729Gossypium hirsutummarker_locus
DPL0095bDPL0095b-31.363Gossypium hirsutummarker_locus
DPL0095aDPL0095a-61.917Gossypium hirsutummarker_locus
DPL0095DPL0095Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ394846GQ394846Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A03chromosomeA03:7847445..7847623 +
D03chromosomeD03:44957780..44957974 -
CM018204.1chromosomeCM018204.1:7759208..7759423 +
CM018217.1chromosomeCM018217.1:45281130..45281302 -
Chr7chromosomeChr7:62003262..62003459 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:104973850..104974047 +
Chr3chromosomeChr3:5385689..5385865 +
D10_02chromosomeD10_02:43603632..43603798 -
CM016615.1chromosomeCM016615.1:103477336..103477502 +
Dt_chr3chromosomeDt_chr3:18358455..18358649 -
At_chr5chromosomeAt_chr5:6709166..6709347 -
scaffold515_A03supercontigscaffold515_A03:187378..187559 -
D03chromosomeD03:39023045..39023225 -
Ghir_A03chromosomeGhir_A03:8691063..8691242 +
Ghir_D03chromosomeGhir_D03:44738401..44738591 -
A03chromosomeA03:8213440..8213621 +
D03chromosomeD03:46251422..46251616 -
A03chromosomeA03:8662229..8662410 +
D03chromosomeD03:45735424..45735616 -
A03chromosomeA03:8080172..8080353 +
D03chromosomeD03:45042457..45042651 -
Dt03chromosomeDt03:41940839..41941011 -
scaffold10280supercontigscaffold10280:73046..73218 -
Gbar_A03chromosomeGbar_A03:7692289..7692496 +
Gbar_D03chromosomeGbar_D03:43704116..43704288 -
A03chromosomeA03:7882604..7882809 +
D03chromosomeD03:46187478..46187650 -
CM017612.1chromosomeCM017612.1:8226412..8226599 +
CM017625.1chromosomeCM017625.1:44530881..44531087 -
CM017638.1chromosomeCM017638.1:8638099..8638316 +
CM017651.1chromosomeCM017651.1:48648999..48649209 -
CM017690.1chromosomeCM017690.1:8092967..8093182 +
CM017703.1chromosomeCM017703.1:46168521..46168741 -
Sequence
>DPL0095 ID=DPL0095|Name=DPL0095|organism=Gossypium hirsutum|type=genetic_marker|length=178bp
ATTGATGACCTGTAGATGACGATGTTTTATGTAATTCAGTAGCATGAGCG
AAAGATGGTGTTTATTCCTGGAATTAAACTAATGTCATTAAAACGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAATAAAACGTTGTTGAATCAGCTTTCT
TGTTCACCATCTTATACTGCAAGCAAAC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr03N/AAD_chr.0370DPL0095bView
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0331.4DPL0095bView
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr17N/AAD_chr.1770DPL0095aView
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr17N/AAD_chr.1761.9DPL0095aView
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr17N/AAD_chr.1751.18MON_DPL0095View
6DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr17-2N/AAD_chr.17-20MON_DPL0095View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr17N/ADt.0361.73DPL0095View
8TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0331.36DPL0095bView
9TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.17N/AAD_chr.1761.92DPL0095aView
10Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr03N/AAD_chr.030DPL0095View
110-153 x sGK9708, RIL (2016)0s-RIL_chr17-3N/AAD_chr.1748.1DPL0095View
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr24N/ADt.08165.1DPL0095View