DC40310, DC40310 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDC40310
Genbank IDGQ394740
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1763
Source Typegenomic
Primer 1DC40310_F: CTTCTCGCCGGTATCTCT
Primer 2DC40310_R: CCTATGGGTTTTCGTTCC
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40310_FDC40310_FGossypium hirsutumprimer
DC40310_RDC40310_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1763MONCS1763Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DC40310DC40310Gossypium hirsutummarker_locus
DC40310DC40310-2.01Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Sequence
>DC40310 ID=DC40310|Name=DC40310|organism=Gossypium hirsutum|type=genetic_marker|length=234bp
CTTCTCGCCGGTATCTCTCTCTCTCTCTCTCTCTCTCTGCTATTTAAAAA
AAGAAAAAGAAAAAAATAAAATTGCTGCTATGAATGTTAAGGGTCTTTGA
TTAAGAGCTATTTTGGGTGAGTTTTTCCTAGCGAATTGAGCTAATATGAG
TTGCAATTAAGGTTTTTGGGGGTCAAGGCTTAGTTAGTTTCTATTATTTA
ATAAAATTTGAAGAAGGGAACGAAAACCCATAGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr18N/AAD_chr.181.2DC40310View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr18N/AAD_chr.180DC40310View
3W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.02139.3DC40310View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr13N/AAD_chr.1320DC40310View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr13N/AAt.132.01DC40310-2.01View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394740