DC40052, DC40052 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDC40052
Genbank IDGQ394574
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1597
Source Typegenomic
Primer 1DC40052_F: CATGCAGCCTACTATGCC
Primer 2DC40052_R: TAACGCCCAACATTATCC
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394574
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40052_FDC40052_FGossypium hirsutumprimer
DC40052_RDC40052_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed palmitic acid contentqFAPAL.YT-RIL_ch01.cq11Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TTT-CSIL_ch01-1.p2-df14Gossypium hirsutumQTL
seed cotton weight per bollqBWT.TTT-CSIL_ch01-1.p2-nj14Gossypium hirsutumQTL
seed cotton weight per bollqBWT.TTT-CSIL_ch01-1.p2-sy15Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DC40052DC40052Gossypium hirsutummarker_locus
DC40052DC40052-52.973Gossypium hirsutummarker_locus
DC40052DC40052-52Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1597MONCS1597Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Sequence
>DC40052 ID=DC40052|Name=DC40052|organism=Gossypium hirsutum|type=genetic_marker|length=147bp
CATGCAGCCTACTATGCCTATCTTACCCACCCAAGGTTCCTTTTTTTTTG
TGTGTGTGTGTGTGTGTGTGTGTGTTCTAAAGTATGTTATTAAAGAATTT
TCTGTAACAAGATTTCAACTTTATTTATGGGATAATGTTGGGCGTTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.0130DC40052
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0163.5DC40052
3TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.0153DC40052
4TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr01-1N/AAD_chr.0134.6DC40052
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-2N/AAD_chr.0171DC40052
60-153 x sGK9708, RIL (2016)0s-RIL_chr01-2N/AAD_chr.0174.1DC40052
7TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.0152.97DC40052
8MGG-293-793, MAGIC (2018)MAGIC-19831_chr01N/AAD_chr.0152DC40052