CIR0364, CIR0364 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0364
AliasCIR364
Genbank IDAJ567297
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567297
Source Typegenomic
Repeat Motif(AC)10
PCR ConditionAnnealing temperature: 51
Primer 1CIR364_F: ACTTTCATTTCGTGTGGT
Primer 2CIR364_R: TGTTCATGCTTGTATCGT
Product Length153
PolymorphismP_ CIR0364
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567297
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR364_FCIR364_FGossypium hirsutumprimer
CIR364_RCIR364_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR364CIR364Gossypium hirsutummarker_locus
C1R364-158C1R364-158Gossypium hirsutummarker_locus
CIR364-139CIR364-139Gossypium hirsutummarker_locus
cir0364cir0364Gossypium hirsutummarker_locus
CIR364/150y(C5)CIR364/150y(C5)Gossypium hirsutummarker_locus
CIR364CIR364-118.523Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567297AJ567297Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:13708233..13708385 +
A05chromosomeA05:14626467..14626610 +
CM018219.1chromosomeCM018219.1:12749476..12749644 +
CM018206.1chromosomeCM018206.1:14318600..14318743 +
D5_05chromosomeD5_05:12152582..12152730 +
Chr10chromosomeChr10:52248968..52249113 +
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:14376210..14376355 +
Chr9chromosomeChr9:19612786..19612952 +
D10_05chromosomeD10_05:48239615..48239757 -
CM016626.1chromosomeCM016626.1:21020690..21020849 +
At_chr3chromosomeAt_chr3:2384338..2384481 +
Dt_chr9chromosomeDt_chr9:55697071..55697223 -
D05chromosomeD05:12848313..12848465 +
A05chromosomeA05:12928677..12928820 +
Ghir_D05chromosomeGhir_D05:13303145..13303297 +
Ghir_A05chromosomeGhir_A05:14558209..14558352 +
D05chromosomeD05:12984876..12985028 +
A05chromosomeA05:14070599..14070742 +
D05chromosomeD05:13140175..13140325 +
A05chromosomeA05:14583297..14583438 +
D05chromosomeD05:13022802..13022954 +
A05chromosomeA05:14832338..14832481 +
scaffold9086supercontigscaffold9086:200457..200600 -
scaffold13660supercontigscaffold13660:45685..45951 -
Gbar_D05chromosomeGbar_D05:13197967..13198133 +
Gbar_A05chromosomeGbar_A05:13948653..13948796 +
D05chromosomeD05:13202340..13202508 +
A05chromosomeA05:14502867..14503010 +
CM017627.1chromosomeCM017627.1:13111043..13111189 +
CM017614.1chromosomeCM017614.1:14298695..14298838 +
CM017653.1chromosomeCM017653.1:13521550..13521700 +
CM017640.1chromosomeCM017640.1:14537078..14537222 +
CM017705.1chromosomeCM017705.1:13116266..13116422 +
CM017692.1chromosomeCM017692.1:14140457..14140602 +
Chr9chromosomeCIR0364:1..256 .
Chr9:19612717..19612986 +
Chr09chromosomeCIR0364:1..256 .
Chr09:12109194..12109447 +
Sequence
>CIR0364 ID=CIR0364|Name=CIR0364|organism=Gossypium hirsutum|type=genetic_marker|length=153bp
ACTTTCATTTCGTGTGGTAAAATCTCGAAGACATTACTCTTTATCATCCT
CTCTAGACCTAACATGATGCCTTCATTAATGAAAACACACACACACACAC
ACACGCACACACTATACTGATTGCTTCATTGAGAAACGATACAAGCATGA
ACA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_D08N/AAD_chr.19134.2CIR364View
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr05N/AAD_chr.0597.3CIR364View
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c05N/AAD_chr.0577.2CIR364View
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c19N/AAD_chr.1966.66CIR364View
5Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr05N/AAD_chr.050CIR364View
6Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.0521.1CIR364View
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0558.5CIR364View
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr19N/AAD_chr.19118.5CIR364View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr19N/ADt.05142.5CIR364View
10Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.19.1N/AAD_chr.1964.3C1R364-158View
11HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr05N/AAD_chr.0563CIR364-139View
12AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.0576cir0364View
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.19134cir0364View
14Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.0521.1CIR364/150y(C5)View
15TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.19N/AAD_chr.19118.52CIR364View