CIR0334, CIR0334 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0334
AliasCIR334
Genbank IDAJ567271
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567271
Source Typegenomic
Repeat Motif(AC)7
PCR ConditionAnnealing temperature: 51
Primer 1CIR334_F: ACCCTTGACAGTTACCAC
Primer 2CIR334_R: TGCCCATTTAGGTATGA
Product Length167
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567271
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR334_FCIR334_FGossypium hirsutumprimer
CIR334_RCIR334_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.0s-RIL_ch15-2.zz10Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR334CIR334Gossypium hirsutummarker_locus
CIR334/180yCIR334/180yGossypium hirsutummarker_locus
CIR334CIR334-44.724Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567271AJ567271Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:56985780..56985959 -
A01chromosomeA01:94806038..94806204 -
CM018215.1chromosomeCM018215.1:55703153..55703322 -
CM018202.1chromosomeCM018202.1:104038224..104038390 -
D5_01chromosomeD5_01:50070480..50070645 -
KI_01chromosomeKI_01:33481063..33481230 -
Chr2chromosomeChr2:60852509..60852677 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:89771711..89771879 -
Chr2chromosomeChr2:6188784..6188949 -
D10_01chromosomeD10_01:6884958..6885140 +
CM016614.1chromosomeCM016614.1:125827873..125828035 -
scaffold39.1supercontigscaffold39.1:1751465..1751630 +
Dt_chr2chromosomeDt_chr2:10797911..10798080 +
scaffold128656supercontigscaffold128656:88..254 +
D01chromosomeD01:54259942..54260121 -
A01chromosomeA01:90791225..90791391 -
Ghir_D01chromosomeGhir_D01:55938671..55938849 -
Ghir_A01chromosomeGhir_A01:108368873..108369039 -
D01chromosomeD01:57634570..57634749 -
A01chromosomeA01:109098513..109098679 -
D01chromosomeD01:57348893..57349062 -
A01chromosomeA01:106697470..106697636 -
D01chromosomeD01:54588261..54588440 -
A01chromosomeA01:103479031..103479197 -
scaffold2675supercontigscaffold2675:631481..631647 +
scaffold2675supercontigscaffold2675:628634..628803 +
scaffold1117supercontigscaffold1117:69854..70023 +
Gbar_D01chromosomeGbar_D01:55928813..55928982 -
Gbar_A01chromosomeGbar_A01:106464373..106464539 -
D01chromosomeD01:56623421..56623590 -
A01chromosomeA01:106468943..106469109 -
CM017623.1chromosomeCM017623.1:56739989..56740162 -
CM017610.1chromosomeCM017610.1:105060724..105060890 -
CM017649.1chromosomeCM017649.1:58200467..58200634 -
CM017636.1chromosomeCM017636.1:112338880..112339046 -
CM017701.1chromosomeCM017701.1:56246417..56246592 -
CM017688.1chromosomeCM017688.1:102606545..102606711 -
Chr2chromosomeCIR0334:1..358 .
Chr2:6188604..6188955 -
Chr02chromosomeCIR0334:1..358 .
Chr02:55891956..55892307 -
Sequence
>CIR0334 ID=CIR0334|Name=CIR0334|organism=Gossypium hirsutum|type=genetic_marker|length=167bp
ACCCTTGACAGTTACCACAGCGCCATCTGCTAACATTACCTTTTTCAAGA
CACCAGCATCCACATCATGCTGCATGATTTAACCATCGACAAGATTAATC
AATTGACTTCAAAAGATTACACACACACACACAAAAGACACATCTTATAG
TCATACCTAAATGGGCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.1575.17CIR334View
2Yumian-1 x T586, RIL (2006)YT-RIL_chr15-3N/AAD_chr.1556.8CIR334View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.1578.6CIR334View
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1544.7CIR334View
5W10 x TM-1, F2:3 (2015)WT-F2:3_chr15N/AAD_chr.1554.5CIR334View
6GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.0173.1CIR334View
7GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr15N/AAD_chr.154.7CIR334View
8GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr15N/AAD_chr.154.7CIR334View
90-153 x sGK9708, RIL (2016)0s-RIL_chr15-2N/AAD_chr.1543.3CIR334View
10Yumian-1 x T586, RIL (2009)YT-RIL_chr15-1N/AAD_chr.1556.8CIR334/180yView
11TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1544.72CIR334View