CIR0332, CIR0332 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0332
AliasCIR332
Genbank IDAJ567269
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567269
Source Typegenomic
Repeat Motif(TG)8
PCR ConditionAnnealing temperature: 51
Primer 1CIR332_F: CTACGCATGAGACGATAC
Primer 2CIR332_R: CAACGCCAATAACAATAC
Product Length167
PolymorphismP_ CIR0332
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567269
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR332_FCIR332_FGossypium hirsutumprimer
CIR332_RCIR332_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR332CIR332Gossypium hirsutummarker_locus
cir0332cir0332Gossypium hirsutummarker_locus
CIR332-330CIR332-330Gossypium hirsutummarker_locus
CIR332CIR332-79.514Gossypium hirsutummarker_locus
CIR332CIR332-88.7Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567269AJ567269Gossypium hirsutumsequence_feature


Sequence
>CIR0332 ID=CIR0332|Name=CIR0332|organism=Gossypium hirsutum|type=genetic_marker|length=167bp
CTACGCATGAGACGATACTTGGAGTTTCTTAGTGTCTGCTATATTATTTT
GGTGCCAATATTATACAATTATAAGGTGTTTTGTGCTTATGTGTGTGTGT
GTGTGCGGGCGCGCGCTTAATTTCATCCGAGTTTGTGTATTATGTATCTG
TATTGTTATTGGCGTTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A03N/AAD_chr.0337.4CIR332
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr03N/AAD_chr.0395.8CIR332
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c03N/AAD_chr.0374CIR332
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0336.86CIR332
5Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch03/A03N/AAD_chr.031.6CIR332
6T582 x Hai-7124, F2 (2010)T5H-F2_chr3N/AAD_chr.0353.3CIR332
7TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0379.5CIR332
8AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03169cir0332
9TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.0353.3CIR332-330
10TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.0352.87CIR332-330
11TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0379.51CIR332
12PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr03N/AAt.0388.7CIR332