CIR0328, CIR0328 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0328
AliasCIR328
Genbank IDAJ567265
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567265
Source Typegenomic
Repeat Motif(CA)5
PCR ConditionAnnealing temperature: 51
Primer 1CIR328_F: ATCCCTATGCTTGTCATC
Primer 2CIR328_R: ATTACCATTCATTCACCAC
Product Length210
PolymorphismP_ CIR0328
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567265
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR328_FCIR328_FGossypium hirsutumprimer
CIR328_RCIR328_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR328CIR328Gossypium hirsutummarker_locus
CIR328-215CIR328-215Gossypium hirsutummarker_locus
CIR328-219CIR328-219Gossypium hirsutummarker_locus
cir0328cir0328Gossypium hirsutummarker_locus
CIR328CIR328-209.112Gossypium hirsutummarker_locus
CIR328bCIR328b-3.851Gossypium hirsutummarker_locus
CIR328CIR328-3.535Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567265AJ567265Gossypium hirsutumsequence_feature


Sequence
>CIR0328 ID=CIR0328|Name=CIR0328|organism=Gossypium hirsutum|type=genetic_marker|length=210bp
ATCCCTATGCTTGTCATCCGATTCCGAGGGCTGACAAAAAGAAGACTAAG
TGTGCATTTCTTTCTTCTTTATTTACTTATTGTTTTGTATATGTGGTAAG
TAGGTTATTGGGATGGTTGGATATATATTCTTTTAGTTTAGTTGAACACA
AACACACACACAGAGTTATGTATAATCCAATCATTTCTGAGGTGGTGAAT
GAATGGTAAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-1N/AAD_chr.050CIR328
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr05N/AAD_chr.0527.9CIR328
3Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr05N/AAD_chr.05337.8CIR328
4Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c05N/AAD_chr.05138.27CIR328
5Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch05N/AAD_chr.05108.93CIR328
6TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.05199.19CIR328
7(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.050CIR328
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.05118.9CIR328
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.053.5CIR328
10CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr22N/ADt.04101.5CIR328
11HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr05N/AAD_chr.0559CIR328-215
12HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr05N/AAD_chr.0559CIR328-219
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05311cir0328
14CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.05209.11CIR328
15CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr22N/ADt.043.85CIR328b
16TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.053.54CIR328