CIR0320, CIR0320 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0320
AliasCIR320
Genbank IDAJ567260
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567260
Source Typegenomic
Repeat Motif(T)9(N)2(TG)8
PCR ConditionAnnealing temperature: 51
Primer 1CIR320_F: CCTCCATAAACCCTCTT
Primer 2CIR320_R: TCACATACGAAGACAACC
Product Length241
PolymorphismP_ CIR0320
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567260
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR320_FCIR320_FGossypium hirsutumprimer
CIR320_RCIR320_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.YT-RIL_chr07-2.cq04Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR320CIR320Gossypium hirsutummarker_locus
cir0320cir0320Gossypium hirsutummarker_locus
CIR320aCIR320aGossypium hirsutummarker_locus
CIR320bCIR320bGossypium hirsutummarker_locus
CIR320/230t(C7)CIR320/230t(C7)Gossypium hirsutummarker_locus
CIR320/300y(C7)CIR320/300y(C7)Gossypium hirsutummarker_locus
CIR320CIR320-117.084Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567260AJ567260Gossypium hirsutumsequence_feature


Sequence
>CIR0320 ID=CIR0320|Name=CIR0320|organism=Gossypium hirsutum|type=genetic_marker|length=241bp
CCTCCATAAACCCTCTTTTATTTCCTTTTTTTCTTTAACTCTGTATGCTC
CCCCAAGATATTCTTTCAAAAAAAAATGGTGATTGCTGAGTGCTCAACAA
CAAGAGAATGTGAAGTTTTTTTTTGTTGTGTGTGTGTGTGTGTNAATTGN
TGGANAATCATTCAATAACCTGAAGAAAGCCAAAATTTCAGGGTTTTTTA
TTGGAGAACAATTCCTGATAAGTGGTTGTCTTCGTATGTGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr07N/AAD_chr.07212CIR320View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c07N/AAD_chr.07112.96CIR320View
3Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch07N/AAD_chr.0774.48CIR320View
4Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A01N/AA_chr.0160.8CIR320View
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c07N/AAD_chr.0722.24CIR320View
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr07N/AAD_chr.07117.1CIR320View
70-153 x sGK9708, RIL (2016)0s-RIL_chr14-2N/AAD_chr.1471.5CIR320View
8AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr07N/AAD_chr.07193cir0320View
9Yumian-1 x T586, RIL (2006)YT-RIL_chr07-1N/AAD_chr.0729.1CIR320aView
10Yumian-1 x T586, RIL (2015)YT-RIL.15_chr07N/AAD_chr.0717.4CIR320aView
11Yumian-1 x T586, RIL (2006)YT-RIL_chr14-3N/AAD_chr.1444.8CIR320bView
12Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.14118.9CIR320bView
13Yumian-1 x T586, RIL (2009)YT-RIL_chr07-2N/AAD_chr.0729.8CIR320/230t(C7)View
14Yumian-1 x T586, RIL (2009)YT-RIL_chr14-1N/AAD_chr.1446.1CIR320/300y(C7)View
15TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.07N/AAD_chr.07117.08CIR320View