CIR0316, CIR0316 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0316
AliasCIR316
Genbank IDAJ567257
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567257
Source Typegenomic
Repeat Motif(AC)8(AT)5
PCR ConditionAnnealing temperature: 51
Primer 1CIR316_F: TTACAGGCACTACCACC
Primer 2CIR316_R: CCTTTCTGGCGACTT
Product Length197
PolymorphismP_ CIR0316
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567257
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR316_FCIR316_FGossypium hirsutumprimer
CIR316_RCIR316_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR316CIR316Gossypium hirsutummarker_locus
cir0316cir0316Gossypium hirsutummarker_locus
CIR316aCIR316aGossypium hirsutummarker_locus
CIR316bCIR316bGossypium hirsutummarker_locus
CIR316cCIR316cGossypium hirsutummarker_locus
CIR316/210t(C21)CIR316/210t(C21)Gossypium hirsutummarker_locus
CIR-316CIR-316Gossypium hirsutummarker_locus
CIR316ND_184CIR316ND_184Gossypium hirsutummarker_locus
CIR316aCIR316a-159.511Gossypium hirsutummarker_locus
CIR316bCIR316b-140.974Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567257AJ567257Gossypium hirsutumsequence_feature


Sequence
>CIR0316 ID=CIR0316|Name=CIR0316|organism=Gossypium hirsutum|type=genetic_marker|length=197bp
TTACAGGCACTACCACCAAAAATCTCAGATAAGTAAAACAAAAAGCAACA
AAACAAGAAATCACCTAAAAGTTAAGACACACAGACACAAAAATACGGAT
AAATGTACATATTAAAATCCGTATGTATACACACACACACACACATATAT
ATATTTGAATTACTCCACCGTCGAATGTGGTGAAGTCGCCAGAAAGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr21/lgD02N/AAD_chr.2115.2CIR316
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.2114.88CIR316
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr11N/AAD_chr.11115.8CIR316
4Yumian-1 x T586, RIL (2006)YT-RIL_chr11-1N/AAD_chr.1133.2CIR316
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.111cir0316
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.2111cir0316
7TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.11bN/AAD_chr.110CIR316a
8TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c11N/AAD_chr.11155.98CIR316a
9NemX x SJ-2, RIL (2005)NS-RIL_chr11/lgA03N/AAD_chr.110CIR316a
10TM-1 x 3-79, RIL (2014)T3-RIL.14_chr11N/AAD_chr.11159.5CIR316a
11TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_LG3N/AAD_unknown0CIR316b
12TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c21N/AAD_chr.21128CIR316b
13TM-1 x 3-79, RIL (2014)T3-RIL.14_chr21N/AAD_chr.21141CIR316b
14TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_LG3N/AAD_unknown10.5CIR316c
15Yumian-1 x T586, RIL (2009)YT-RIL_chr11-1N/AAD_chr.1133.2CIR316/210t(C21)
16ST-474 x Auburn 634 RNR, F2 (2007)STA-F2_chr11/lgA03N/AAD_chr.1183.8CIR-316
17GB713 x Nem-X, F2 (2011)GN-F2_chr21N/AAD_chr.21206.4CIR316ND_184
18TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.11N/AAD_chr.11159.51CIR316a
19TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.21N/AAD_chr.21140.97CIR316b