CIR0216, CIR0216 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCIR0216
AliasCIR216
Genbank IDAJ567162
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567162
Source Typegenomic
Repeat Motif(CA)9
PCR ConditionAnnealing temperature: 55
Primer 1CIR216_F: ATCTGAACCATCATCCTC
Primer 2CIR216_R: TTCTGATTGGCACTTTC
Product Length139
PolymorphismP_ CIR0216
Publication[view all]
CommentPrimer data obtained in 2005
Germplasm
Stock NameType
Guazuncho-2obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567162
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR216_FCIR216_FGossypium hirsutumprimer
CIR216_RCIR216_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.GG-F2_ch18-1.hd08Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR216CIR216Gossypium hirsutummarker_locus
CIR216-137CIR216-137Gossypium hirsutummarker_locus
cir0216cir0216Gossypium hirsutummarker_locus
CIR216/150t(C18)CIR216/150t(C18)Gossypium hirsutummarker_locus
CIR216_141CIR216_141Gossypium hirsutummarker_locus
CIR216CIR216-104.699Gossypium hirsutummarker_locus
CIR216CIR216-107.982Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567162AJ567162Gossypium hirsutumsequence_feature


Sequence
>CIR0216 ID=CIR0216|Name=CIR0216|organism=Gossypium hirsutum|type=genetic_marker|length=139bp
ATCTGAACCATCATCCTCAAATGCCTGCACACACACACACACACAAAAAA
AAACAAGAAAAAAGAGAAAGTCCCAATTAGTTAAGGGATTATCAATCAAG
TTCTGCAACTGTATGAGTGAAGGAAAGTGCCAATCAGAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr18N/AAD_chr.1837.1CIR216
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr18N/AAD_chr.189.4CIR216
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c18N/AAD_chr.1810.02CIR216
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch18N/AAD_chr.1810.62CIR216
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c18N/AAD_chr.18102.99CIR216
6Yumian-1 x T586, RIL (2006)YT-RIL_chr18N/AAD_chr.1896.8CIR216
7Li2 x DP5690, F2 (2011)Li2D-F2_chr18N/AAD_chr.182.43CIR216
8H18 x 3-79, F2 (2005)H18P379-F2_chr18N/AAD_chr.18173.1CIR216
9Yumian-1 x T586, RIL (2015)YT-RIL.15_chr18N/AAD_chr.1878.3CIR216
10Yumian-1 x 7235, RIL (2015)Y7-RIL_chr18N/AAD_chr.1846.8CIR216
11TM-1 x 3-79, RIL (2014)T3-RIL.14_chr18N/AAD_chr.18108CIR216
12GX1135 x GX100-2, F2 (2013)GG-F2_chr18-1N/AAD_chr.1889.8CIR216
13HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr18N/AAD_chr.185CIR216-137
14AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.1884cir0216
15Yumian-1 x T586, RIL (2009)YT-RIL_chr18-1N/AAD_chr.180CIR216/150t(C18)
16GB713 x Nem-X, F2 (2011)GN-F2_chr18N/AAD_chr.1881.2CIR216_141
17CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr18N/ADt.13104.7CIR216
18TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.18N/AAD_chr.18107.98CIR216