CGR6378, CGR6378 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR6378
Genbank IDGQ394036
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS1001
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR6378_F: CCATGTTGGATATGGCTACG
Primer 2CGR6378_R: AACCCTCAACCAACCTTGAA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394036
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR6378_FCGR6378_FGossypium hirsutumprimer
CGR6378_RCGR6378_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1001MONCS1001Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON_CGR6378MON_CGR6378Gossypium hirsutummarker_locus
CGR6378CGR6378Gossypium hirsutummarker_locus
CGR6378CGR6378-42.738Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Sequence
>CGR6378 ID=CGR6378|Name=CGR6378|organism=Gossypium hirsutum|type=genetic_marker|length=292bp
CCATGTTGGATATGGCTACGTGAAAACCCACCTAATTTAAGAAGAAATTG
AAAAAAATAACCCTAACAACAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGAAGA
GACTGTAAAATTGTTGAGGTTTTTTTCCCATATTATTTTTCTTCTTCCCT
TAATTGTTGCTATTGTGGATTAGAAACAATAATTAACAAACCAAGGTGTT
GGATTAGAAATCAATTTCAAGGTTCAAGGTTGGTTGAGGGTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.0167.7MON_CGR6378
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.0131.6CGR6378
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.0176.1CGR6378
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.01109.7CGR6378
5CCRI-36 x G2005, RIL (2016)CG-RIL_chr15N/AAD_chr.152.6CGR6378
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0142.74CGR6378