CGR6356, CGR6356 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR6356
Genbank IDGQ394029
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0994
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR6356_F: ACCCACCACAGATCTGCAA
Primer 2CGR6356_R: CAGATCACATCCTACTTCGTCAA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR6356_FCGR6356_FGossypium hirsutumprimer
CGR6356_RCGR6356_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR6356CGR6356Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0994MONCS0994Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Sequence
>CGR6356 ID=CGR6356|Name=CGR6356|organism=Gossypium hirsutum|type=genetic_marker|length=144bp
ACCCACCACAGATCTGCAAAAAATGAAAAAAGATAAAAATTTGTAAACAA
ACCCAGATTAAAAAGAACAAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGATTTTGAAGAAAATTTTGACGAAGTAGGATGTGATCTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.0170CGR6356View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0158.8CGR6356View
3W10 x TM-1, F2:3 (2015)WT-F2:3_chr01-1N/AAD_chr.0131.2CGR6356View
4GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-2N/AAD_chr.0156.4CGR6356View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394029