CGR6129, CGR6129 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR6129
Genbank IDGQ393966
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0931
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR6129_F: TTCCTTCACCAACGCTTCTT
Primer 2CGR6129_R: CGAGAGTTCTTGAGGGATCG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393966
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR6129_FCGR6129_FGossypium hirsutumprimer
CGR6129_RCGR6129_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed oil contentqSOC.GVG-RIL_ch01.cz12-rilGossypium hirsutumQTL
fiber strengthqFS.GG-F2_ch08.sy07Gossypium hirsutumQTL
fiber elongationqFEL.0s-RIL_ch15-1.qz08Gossypium hirsutumQTL
fiber elongationqFEL.0s-RIL_ch15-1.qz09Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR6129CGR6129Gossypium hirsutummarker_locus
MON_CGR6129MON_CGR6129Gossypium hirsutummarker_locus
CGR6129aCGR6129aGossypium hirsutummarker_locus
CGR6129bCGR6129bGossypium hirsutummarker_locus
CGR6129CGR6129-9.228Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0931MONCS0931Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:1644875..1645012 +
A01chromosomeA01:2162737..2162868 +
CM018215.1chromosomeCM018215.1:1585279..1585413 +
CM018202.1chromosomeCM018202.1:1651601..1651732 +
D5_01chromosomeD5_01:1467210..1467344 +
KI_01chromosomeKI_01:1584746..1584877 +
Chr7chromosomeChr7:37675196..37675327 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:1652177..1652308 +
Chr8chromosomeChr8:21060017..21060151 -
D10_01chromosomeD10_01:58990799..58990936 -
CM016614.1chromosomeCM016614.1:2245200..2245331 +
scaffold2140.1supercontigscaffold2140.1:105529..105660 +
scaffold783.1supercontigscaffold783.1:489732..489869 -
D01chromosomeD01:1568788..1568925 +
A01chromosomeA01:1351269..1351400 +
Ghir_D01chromosomeGhir_D01:1619510..1619647 +
Ghir_A01chromosomeGhir_A01:1893986..1894117 +
D01chromosomeD01:1570483..1570620 +
A01chromosomeA01:1842504..1842635 +
D01chromosomeD01:1597558..1597695 +
A01chromosomeA01:1913811..1913942 +
D01chromosomeD01:1410228..1410365 +
A01chromosomeA01:1879215..1879346 +
Dt01chromosomeDt01:1842425..1842559 +
scaffold13138supercontigscaffold13138:134179..134313 +
scaffold15070supercontigscaffold15070:155741..155872 -
Gbar_D01chromosomeGbar_D01:1680180..1680314 +
Gbar_A01chromosomeGbar_A01:1646482..1646613 +
D01chromosomeD01:1612790..1612924 +
A01chromosomeA01:1642908..1643039 +
CM017623.1chromosomeCM017623.1:1712999..1713133 +
CM017610.1chromosomeCM017610.1:1880681..1880812 +
CM017649.1chromosomeCM017649.1:1535888..1536022 +
CM017636.1chromosomeCM017636.1:1695027..1695158 +
CM017701.1chromosomeCM017701.1:1809656..1809790 +
CM017688.1chromosomeCM017688.1:1689281..1689412 +
Chr02chromosomeCGR6129:2..575 .
Chr02:1443968..1444538 +
Chr8chromosomeCGR6129:2..575 .
Chr8:21059629..21060199 -
Sequence
>CGR6129 ID=CGR6129|Name=CGR6129|organism=Gossypium hirsutum|type=genetic_marker|length=138bp
TTCCTTCACCAACGCTTCTTCCGTTCATTCCTCCGACGATCCTGACCCTA
ACCCTATAAACTCCAAATTCAAATCCAGTTTCCCTTCCCTTTCCTCTTCT
TCTTCTTCTTCTTCTTCCCGATCCCTCAAGAACTCTCG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr15N/AAD_chr.15130CGR6129
2GX1135 x GX100-2, F2 (2013)GG-F2_chr08N/AAD_chr.0844CGR6129
3GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.0124.9CGR6129
4GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr01N/AAD_chr.01132.6CGR6129
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.01147.6CGR6129
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.01109.98MON_CGR6129
7DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.15109.98MON_CGR6129
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr11-1N/AAD_chr.11-146.6MON_CGR6129
90-153 x sGK9708, RIL (2016)0s-RIL_chr15-1N/AAD_chr.1511.8CGR6129a
100-153 x sGK9708, RIL (2016)0s-RIL_chr15-1N/AAD_chr.1512.9CGR6129b
11CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.019.23CGR6129