CGR6012, CGR6012 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR6012
Genbank IDGQ393865
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0830
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR6012_F: ATGTGCCTTGTCCTCTTCCA
Primer 2CGR6012_R: GGGATGTGAGGGCATCATAG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393865
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR6012_FCGR6012_FGossypium hirsutumprimer
CGR6012_RCGR6012_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR6012CGR6012Gossypium hirsutummarker_locus
MON_CGR6012MON_CGR6012Gossypium hirsutummarker_locus
CGR6012CGR6012-82.226Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0830MONCS0830Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D12chromosomeD12:47493483..47493622 +
A12chromosomeA12:82554618..82554753 +
A12chromosomeA12:82516336..82516472 +
CM018226.1chromosomeCM018226.1:44187373..44187520 +
CM018213.1chromosomeCM018213.1:79485266..79485401 +
D5_12chromosomeD5_12:15424653..15424797 -
KI_12chromosomeKI_12:10539500..10539643 -
Chr12chromosomeChr12:43654361..43654493 +
Chr12_CRI-A2_v1.0.a1chromosomeChr12_CRI-A2_v1.0.a1:20546589..20546721 -
Chr8chromosomeChr8:29448535..29448682 +
D10_12chromosomeD10_12:39160485..39160628 +
CM016625.1chromosomeCM016625.1:112274340..112274474 -
scaffold1830.1supercontigscaffold1830.1:23842..23978 +
Dt_chr8chromosomeDt_chr8:40942359..40942498 +
D12chromosomeD12:43663423..43663562 +
A12chromosomeA12:68759735..68759871 +
Ghir_D12chromosomeGhir_D12:46682369..46682508 +
Ghir_A12chromosomeGhir_A12:87211432..87211568 +
D12chromosomeD12:45761284..45761423 +
A12chromosomeA12:88109347..88109483 +
D12chromosomeD12:46656009..46656146 +
A12chromosomeA12:85307773..85307909 +
D12chromosomeD12:44509751..44509898 +
A12chromosomeA12:82455217..82455353 +
Dt12chromosomeDt12:45810543..45810690 +
At12chromosomeAt12:72547866..72548001 +
scaffold354supercontigscaffold354:18386..18521 +
scaffold3102supercontigscaffold3102:421643..421790 +
Gbar_D12chromosomeGbar_D12:43475233..43475380 +
Gbar_A12chromosomeGbar_A12:81907625..81907760 +
D12chromosomeD12:44691095..44691236 +
A12chromosomeA12:81423953..81424088 +
CM017634.1chromosomeCM017634.1:44660502..44660647 +
CM017621.1chromosomeCM017621.1:82958378..82958513 +
CM017660.1chromosomeCM017660.1:47175180..47175323 +
CM017647.1chromosomeCM017647.1:86073886..86074021 +
CM017712.1chromosomeCM017712.1:45284970..45285117 +
CM017699.1chromosomeCM017699.1:81884821..81884956 +
Sequence
>CGR6012 ID=CGR6012|Name=CGR6012|organism=Gossypium hirsutum|type=genetic_marker|length=146bp
ATGTGCCTTGTCCTCTTCCAGGACACACACACACACACACACACACAAAT
CCCTTTATTAATGAAAACACCGTGAGACCCTCGACGCACGCGCTGCGACA
ACAACGGACAAAGCCCACTTTATTTACTATGATGCCCTCACATCCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr12N/AAD_chr.1250CGR6012View
2Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr26N/AAD_chr.269.8CGR6012View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr26N/AAD_chr.2689CGR6012View
4LMY28 x XLZ24, RIL (2018)LX-RIL_chr26N/AAD_chr.2616.25CGR6012View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr12N/AAD_chr.1239.4MON_CGR6012View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr26N/AAD_chr.2665.93MON_CGR6012View
7DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr26N/AAD_chr.2648.8MON_CGR6012View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr26N/ADt.1282.23CGR6012View