CGR5590, CGR5590 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR5590
Genbank IDGQ393586
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0551
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5590_F: TCAACCGATCTCCAATCTCC
Primer 2CGR5590_R: AACCCAGCGAATCAGAATTG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393586
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5590_FCGR5590_FGossypium hirsutumprimer
CGR5590_RCGR5590_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.BT-F2:3_chr05.2011Gossypium hirsutumQTL
lint percentqLP.BT-F2:3_chr19-3.2011Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5590CGR5590Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0551MONCS0551Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:4038222..4038381 -
A05chromosomeA05:4622579..4622750 -
CM018219.1chromosomeCM018219.1:3740088..3740247 -
CM018206.1chromosomeCM018206.1:4551955..4552132 -
D5_05chromosomeD5_05:3615619..3615778 -
KI_05chromosomeKI_05:3292765..3292924 -
Chr1chromosomeChr1:59091896..59092061 +
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:4454556..4454721 -
Chr9chromosomeChr9:3000248..3000407 +
D10_05chromosomeD10_05:56874738..56874897 +
CM016626.1chromosomeCM016626.1:6743731..6743902 -
Dt_chr9chromosomeDt_chr9:65508498..65508657 +
D05chromosomeD05:3873712..3873871 -
A05chromosomeA05:4066947..4067118 -
Ghir_D05chromosomeGhir_D05:4011911..4012070 -
Ghir_A05chromosomeGhir_A05:4616990..4617161 -
D05chromosomeD05:3811740..3811899 -
A05chromosomeA05:4475662..4475833 -
D05chromosomeD05:3923049..3923208 -
A05chromosomeA05:4580282..4580453 -
D05chromosomeD05:3783463..3783622 -
A05chromosomeA05:4999731..4999902 -
scaffold12880supercontigscaffold12880:169776..169953 +
Gbar_D05chromosomeGbar_D05:3924721..3924880 -
Gbar_A05chromosomeGbar_A05:4244885..4245062 -
D05chromosomeD05:4060080..4060239 -
A05chromosomeA05:4729125..4729302 -
CM017627.1chromosomeCM017627.1:3883468..3883627 -
CM017614.1chromosomeCM017614.1:4591553..4591724 -
CM017653.1chromosomeCM017653.1:4106145..4106304 -
CM017640.1chromosomeCM017640.1:4634518..4634689 -
CM017705.1chromosomeCM017705.1:3891865..3892024 -
CM017692.1chromosomeCM017692.1:4523007..4523178 -
Chr9chromosomeCGR5590:8..336 .
Chr9:3000155..3000471 +
Chr09chromosomeCGR5590:8..336 .
Chr09:3604577..3604893 -
Sequence
>CGR5590 ID=CGR5590|Name=CGR5590|organism=Gossypium hirsutum|type=genetic_marker|length=172bp
TCAACCGATCTCCAATCTCCACTCGGACAACTCGCTTCTCAACTCACCGA
CTCCGACCTCCGACTCACTGCTTATGACGTCTTCCTCGCCGTATGCCGTA
CCTCCTCTTCGAAACCTCTCTCCTCTTCCGCTTCCGCTTCCGCTTCCGCT
TCCAATTCTGATTCGCTGGGTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr05N/AAD_chr.05190CGR5590View
2Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr05N/AAD_chr.0535CGR5590View
3Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr19-3N/AAD_chr.1935CGR5590View
4GX1135 x GX100-2, F2 (2013)GG-F2_chr05-2N/AAD_chr.0522.8CGR5590View
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr19N/ADt.05195.1CGR5590View
6LMY28 x XLZ24, RIL (2018)LX-RIL_chr19N/AAD_chr.1922.65CGR5590View