CGR5579, CGR5579 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR5579
Genbank IDGQ393576
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0541
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5579_F: AGCACTGCTTGCCTTCATTT
Primer 2CGR5579_R: GGGTTGTTTCAAGCGTAGATCA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393576
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5579_FCGR5579_FGossypium hirsutumprimer
CGR5579_RCGR5579_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5579aCGR5579aGossypium hirsutummarker_locus
CGR5579bCGR5579bGossypium hirsutummarker_locus
MON_CGR5579MON_CGR5579Gossypium hirsutummarker_locus
CGR5579CGR5579Gossypium hirsutummarker_locus
CGR5579CGR5579-37.535Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0541MONCS0541Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A01chromosomeA01:44201011..44201121 -
CM018202.1chromosomeCM018202.1:40767515..40767617 -
Chr7chromosomeChr7:122403036..122403136 +
Chr3chromosomeChr3:91899856..91899966 -
Chr08_CRI-A2_v1.0.a1chromosomeChr08_CRI-A2_v1.0.a1:116659774..116659884 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:29070794..29070894 +
A01chromosomeA01:41772871..41772981 -
Ghir_A13chromosomeGhir_A13:19345040..19345136 +
Ghir_A13chromosomeGhir_A13:70071509..70071603 +
Ghir_A12chromosomeGhir_A12:76968395..76968491 +
Ghir_A09chromosomeGhir_A09:33106484..33106580 +
Ghir_A04chromosomeGhir_A04:71988657..71988753 +
Ghir_A03chromosomeGhir_A03:19606360..19606456 +
Ghir_A11chromosomeGhir_A11:48390642..48390738 -
Ghir_A08chromosomeGhir_A08:97626458..97626554 -
Ghir_A06chromosomeGhir_A06:100531165..100531261 -
Ghir_A06chromosomeGhir_A06:69228668..69228764 -
Ghir_A05chromosomeGhir_A05:46760794..46760892 -
Ghir_A05chromosomeGhir_A05:46734693..46734791 -
Ghir_A03chromosomeGhir_A03:72532032..72532128 -
Ghir_A01chromosomeGhir_A01:43272552..43272662 -
A01chromosomeA01:42663014..42663124 -
A01chromosomeA01:42924230..42924340 -
A01chromosomeA01:42580023..42580133 -
At13chromosomeAt13:20434376..20434472 +
At13chromosomeAt13:20442778..20442874 +
At03chromosomeAt03:18722830..18722925 +
At01chromosomeAt01:44441537..44441639 -
scaffold7989supercontigscaffold7989:115668..115764 +
scaffold7989supercontigscaffold7989:107266..107362 +
scaffold6310supercontigscaffold6310:80301..80397 +
scaffold2648supercontigscaffold2648:137825..137920 +
scaffold2195supercontigscaffold2195:164897..164993 +
scaffold2195supercontigscaffold2195:162888..162984 +
scaffold813supercontigscaffold813:97276..97372 -
scaffold711supercontigscaffold711:81972..82068 -
scaffold6079supercontigscaffold6079:47488..47590 -
scaffold5087supercontigscaffold5087:22073..22171 -
scaffold11132supercontigscaffold11132:39112..39208 -
Gbar_A13chromosomeGbar_A13:19733402..19733498 +
Gbar_A08chromosomeGbar_A08:44865752..44865850 +
Gbar_A06chromosomeGbar_A06:47971527..47971623 +
Gbar_A04chromosomeGbar_A04:68728694..68728790 +
Gbar_A03chromosomeGbar_A03:18345657..18345752 +
Gbar_A08chromosomeGbar_A08:94637015..94637111 -
Gbar_A06chromosomeGbar_A06:92672686..92672782 -
Gbar_A03chromosomeGbar_A03:67546114..67546210 -
Gbar_A01chromosomeGbar_A01:41072201..41072303 -
Gbar_A01chromosomeGbar_A01:97561109..97561205 -
A01chromosomeA01:41021838..41021940 -
CM017610.1chromosomeCM017610.1:43022946..43023050 -
CM017636.1chromosomeCM017636.1:44661108..44661206 -
CM017688.1chromosomeCM017688.1:41182894..41182998 -
Sequence
>CGR5579 ID=CGR5579|Name=CGR5579|organism=Gossypium hirsutum|type=genetic_marker|length=111bp
AGCACTGCTTGCCTTCATTTCTTGCTTCCTCTCTCTCTCTCTCTCTCTCT
CTCTTCCATCTCAGGGCAATCGCCAATAAAGTGGTCTAATGATCTACGCT
TGAAACAACCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.0190CGR5579a
2Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.1390CGR5579b
3(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.0142.1MON_CGR5579
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.0147CGR5579
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.0183.4CGR5579
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.01113.6CGR5579
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0137.54CGR5579