CGR5007, CGR5007 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR5007
Genbank IDGQ393185
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0150
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5007_F: GGGTGGAGAAGACGAGAGC
Primer 2CGR5007_R: TGGCGACTGAACAACAAAGA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5007_FCGR5007_FGossypium hirsutumprimer
CGR5007_RCGR5007_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0150MONCS0150Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5007CGR5007Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:201503..201696 -
A02chromosomeA02:155469..155656 -
CM018216.1chromosomeCM018216.1:180097..180290 -
CM018203.1chromosomeCM018203.1:144296..144483 -
D5_03chromosomeD5_03:62853701..62853900 +
KI_03chromosomeKI_03:157949..158136 -
Chr5chromosomeChr5:26238828..26239013 +
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:153405..153590 -
Chr5chromosomeChr5:146742..146941 -
D10_03chromosomeD10_03:61251411..61251605 -
At_chr1chromosomeAt_chr1:106787071..106787264 +
scaffold1428.1supercontigscaffold1428.1:159813..160000 -
D02chromosomeD02:192000..192193 -
A02chromosomeA02:146046..146233 -
Ghir_A02chromosomeGhir_A02:173949..174139 +
Ghir_D02chromosomeGhir_D02:194218..194411 -
Ghir_A02chromosomeGhir_A02:179382..179569 -
D02chromosomeD02:191942..192135 -
A02chromosomeA02:196344..196531 -
D02chromosomeD02:193097..193290 -
A02chromosomeA02:167511..167698 -
D02chromosomeD02:192880..193073 -
A02chromosomeA02:170878..171065 -
scaffold46912supercontigscaffold46912:1502..1695 +
scaffold26500supercontigscaffold26500:36171..36364 +
scaffold26500supercontigscaffold26500:44037..44224 +
Gbar_D02chromosomeGbar_D02:187792..187983 -
Gbar_A02chromosomeGbar_A02:76728..76915 -
D02chromosomeD02:184755..184948 -
A02chromosomeA02:128097..128284 -
CM017624.1chromosomeCM017624.1:185169..185362 -
CM017611.1chromosomeCM017611.1:171384..171571 -
CM017650.1chromosomeCM017650.1:198300..198495 -
CM017637.1chromosomeCM017637.1:158664..158851 -
CM017689.1chromosomeCM017689.1:146360..146547 -
Sequence
>CGR5007 ID=CGR5007|Name=CGR5007|organism=Gossypium hirsutum|type=genetic_marker|length=194bp
GGGTGGAGAAGACGAGAGCTCATCTCTCTGCTTCAAAGTTTGTTCCTTTA
TTCCTTTCAAACCCTTTCCTTTTTTTAACTTGATTTCATTTTCTCAGATT
TGTTCTTTTTCTCTCTCTCTCTCTCTCTCCAGGCTCCTGTCCAGGTAGAA
TTCTCTTCTTCCTTTGCGTTGTGTTCTTTGTTGTTCAGTCGCCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.0247.9CGR5007View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393185