BNL4094, BNL4094 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL4094
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL4094_orig
Source Typegenomic
Repeat Motif(GA)15
PCR ConditionAnnealing temperature: 55
Primer 1BNL4094_F: ATGCTGCGGAGTCGATATCT
Primer 2BNL4094_R: AAATTGATTTCATGCCGGAG
PolymorphismP_ BNL4094
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL4094_FBNL4094_FGossypium hirsutumprimer
BNL4094_RBNL4094_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL4094BNL4094Gossypium hirsutummarker_locus
BNL4094*BNL4094*Gossypium hirsutummarker_locus
BNL4094-190BNL4094-190Gossypium hirsutummarker_locus
BNL4094BNL4094-132.9Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL4094_origBNL4094_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D11chromosomeD11:21457639..21457880 -
A11chromosomeA11:25352158..25352340 -
CM018225.1chromosomeCM018225.1:20348725..20349200 -
CM018212.1chromosomeCM018212.1:24286808..24286982 -
D5_11chromosomeD5_11:45785213..45785400 +
KI_11chromosomeKI_11:14239981..14240201 -
Chr4chromosomeChr4:38683037..38683213 -
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:98350447..98350623 +
Chr7chromosomeChr7:32540640..32540827 +
CM016624.1chromosomeCM016624.1:33540554..33540749 -
Dt_chr7chromosomeDt_chr7:21979997..21980220 -
scaffold58805supercontigscaffold58805:243..425 +
D11chromosomeD11:20414288..20414763 -
A11chromosomeA11:24633301..24633483 -
Ghir_D11chromosomeGhir_D11:20955237..20955482 -
Ghir_A11chromosomeGhir_A11:25187659..25187841 -
D11chromosomeD11:20392903..20393128 -
A11chromosomeA11:24265001..24265183 -
A11chromosomeA11:24921258..24921440 -
D11chromosomeD11:20764067..20764310 -
A11chromosomeA11:25354536..25354718 -
At11chromosomeAt11:26542961..26543135 -
scaffold9977supercontigscaffold9977:153126..153300 -
scaffold15831supercontigscaffold15831:183392..183589 -
scaffold15831supercontigscaffold15831:179971..180655 -
Gbar_D11chromosomeGbar_D11:20649136..20649609 -
Gbar_A11chromosomeGbar_A11:24093386..24093560 -
D11chromosomeD11:20515193..20515668 -
A11chromosomeA11:24223214..24223388 -
CM017633.1chromosomeCM017633.1:20466836..20467039 -
CM017620.1chromosomeCM017620.1:24822612..24822806 -
CM017659.1chromosomeCM017659.1:20944154..20944357 -
CM017646.1chromosomeCM017646.1:24990798..24990970 -
CM017711.1chromosomeCM017711.1:20525816..20526019 -
CM017698.1chromosomeCM017698.1:24600199..24600373 -
Chr07chromosomeBNL4094:1..366 .
Chr07:19879009..19879379 -
Chr7chromosomeBNL4094:1..366 .
Chr7:32540592..32540962 +
Sequence
>BNL4094 ID=BNL4094|Name=BNL4094|organism=Gossypium hirsutum|type=genetic_marker|length=183bp
ATGCTGCGGAGTCGATATCTAGAAACCTGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAAATTTATTAAATTTTCTGAAATTTGGAATGTCNAAAGAAAGA
ATTCGAGATCCTAAAATTGATCGTGTTCGAATTCAAGAAATTCANATAAA
ACAGAAAAGGCAACTCCGGCATGAAATCAATTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A03N/AAD_chr.11114.9BNL4094
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr11/lgA03N/AAD_chr.11114.9BNL4094
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c11N/AAD_chr.11100.61BNL4094
4Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr11N/AAD_chr.1190BNL4094
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.11117BNL4094
6Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg8/chr11N/AAD_chr.1164.2BNL4094
7Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr11N/AAD_chr.11115.14BNL4094
8NemX x SJ-2, RIL (2005)NS-RIL_chr11/lgA03N/AAD_chr.11237.2BNL4094
9Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr11/lgA03N/AAD_chr.11242.1BNL4094*
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.1185.2BNL4094-190
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.1183.74BNL4094-190
12Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgA03.1N/AAD_chr.11107BNL4094-190
13PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.11132.9BNL4094
Image
File NameLegend
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]