BNL3545, BNL3545 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL3545
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL3545_orig
Source Typegenomic
Repeat Motif(CA)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL3545_F: AGTCAGTTTTTTGTTAGCAATATGC
Primer 2BNL3545_R: AACCATTAATTCCCTATTTAACCG
PolymorphismP_ BNL3545
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL3545_FBNL3545_FGossypium hirsutumprimer
BNL3545_RBNL3545_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.LX-RIL_ch02.13AYGossypium hirsutumQTL
fiber elongationqFEL.9s-F2.ch02.ay12.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3545-187BNL3545-187Gossypium hirsutummarker_locus
BNL3545-114BNL3545-114Gossypium hirsutummarker_locus
BNL3545-118BNL3545-118Gossypium hirsutummarker_locus
BNL3545cBNL3545cGossypium hirsutummarker_locus
BNL3545aBNL3545aGossypium hirsutummarker_locus
BNL3545bBNL3545bGossypium hirsutummarker_locus
BNL3545BNL3545Gossypium hirsutummarker_locus
BNL3545-1BNL3545-1Gossypium hirsutummarker_locus
BNL3545-2BNL3545-2Gossypium hirsutummarker_locus
BNL3545/150tBNL3545/150tGossypium hirsutummarker_locus
BNL3545cBNL3545c-119Gossypium hirsutummarker_locus
BNL3545aBNL3545a-7.55Gossypium hirsutummarker_locus
BNL3545BNL3545-176.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3545_origBNL3545_origGossypium hirsutumsequence_feature


Sequence
>BNL3545 ID=BNL3545|Name=BNL3545|organism=Gossypium hirsutum|type=genetic_marker|length=183bp
AGTCAGTTTTTTGTTAGCAATATGCAATATGAACACACACACACACACAC
ACAGATGTATGTATATAAGGGTTGATTTGCAAGTCAATGGACGTGACTGA
TTTTCATGCAATTATTTGTATTTATTAAAATATTTAGATTTTTTTTTAAG
ATTTTCAACCGGTTAAATAGGGAATTAATGGTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr02N/AAD_chr.0223BNL3545-187
2HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr14N/AAD_chr.140BNL3545-114
3HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr14N/AAD_chr.142BNL3545-118
4Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0270BNL3545c
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.02117.49BNL3545c
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.02119BNL3545c
7Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr14N/AAD_chr.14150BNL3545a
8TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.14118.87BNL3545a
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.147.6BNL3545a
10Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr14N/AAD_chr.14150BNL3545b
11TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.14118.87BNL3545b
12Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr14N/AAD_chr.14150BNL3545
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.02181BNL3545
14Yumian-1 x T586, RIL (2006)YT-RIL_chr14-1N/AAD_chr.145BNL3545
15(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr14-2N/AAD_chr.14100.5BNL3545
16DH962 x Jinmian-6, F2 (2009)DJ-F2_chr14.1N/AAD_chr.1433.1BNL3545
17DH962 x Jinmian-6, F2 (2009)DJ-F2_chr14/LG27N/AAD_chr.1433.1BNL3545
18Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.142.1BNL3545
19Yumian-1 x 7235, RIL (2015)Y7-RIL_chr02N/AAD_chr.023.6BNL3545
20DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr14-2N/AAD_chr.1426.74BNL3545
21GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr02-2N/AAD_chr.020BNL3545
22DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr14-4N/AAD_chr.14-40BNL3545
23CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0220.8BNL3545
24CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr14N/AAD_chr.1475.9BNL3545
25CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr14N/ADt.020BNL3545
26LMY28 x XLZ24, RIL (2018)LX-RIL_chr02N/AAD_chr.025.86BNL3545
27901-001 x sGK156, F2 (2019)Chr02N/AAD_chr.0220.77BNL3545
28Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg35N/AAD_unknown0BNL3545-1
29Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg6/chr02N/AAD_chr.029.3BNL3545-2
30Yumian-1 x T586, RIL (2009)YT-RIL_chr14-2N/AAD_chr.1410.1BNL3545/150t
31TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.02119BNL3545c
32TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.147.55BNL3545a
33PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr14N/ADt.02176.3BNL3545