BNL3452, BNL3452 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL3452
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL3452_orig
Source Typegenomic
Repeat Motif(CA)13
PCR ConditionAnnealing temperature: 55
Primer 1BNL3452_F: TGTAACTGAGCAGCCGTACG
Primer 2BNL3452_R: GCCAAAGCAGAGTGAGATCC
PolymorphismP_ BNL3452
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL3452_FBNL3452_FGossypium hirsutumprimer
BNL3452_RBNL3452_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
leaf shapeqLFSP.TH-BC1_ch19.1Gossypium spp.QTL
lint percentqLP.BT-F2:3_chr19-1.2011Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.MAGIC-19831_ch19.zk15Gossypium spp.QTL
fiber lengthqUHML.MAGIC-19831_ch19.hg14Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3452BNL3452Gossypium hirsutummarker_locus
BNL3452aBNL3452aGossypium hirsutummarker_locus
BNL3452bBNL3452bGossypium hirsutummarker_locus
BNL3452-170BNL3452-170Gossypium hirsutummarker_locus
BNL3452-180BNL3452-180Gossypium hirsutummarker_locus
BNL3452-195BNL3452-195Gossypium hirsutummarker_locus
BNL3452aBNL3452a-180.211Gossypium hirsutummarker_locus
BNL3452bBNL3452b-160.174Gossypium hirsutummarker_locus
BNL3452BNL3452-214.1Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3452_origBNL3452_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:3937172..3937362 -
CM018219.1chromosomeCM018219.1:3639161..3639357 -
D5_05chromosomeD5_05:3523964..3524146 -
Chr9chromosomeChr9:3092341..3092521 +
D10_05chromosomeD10_05:56985040..56985218 +
Dt_chr9chromosomeDt_chr9:65608970..65609160 +
D05chromosomeD05:3777082..3777272 -
Ghir_D05chromosomeGhir_D05:3910939..3911127 -
D05chromosomeD05:3710987..3711177 -
D05chromosomeD05:3822007..3822197 -
D05chromosomeD05:3682407..3682597 -
scaffold1848supercontigscaffold1848:51566..51764 +
Gbar_D05chromosomeGbar_D05:3810233..3810427 -
D05chromosomeD05:3958740..3958936 -
CM017627.1chromosomeCM017627.1:3779270..3779460 -
CM017653.1chromosomeCM017653.1:3967546..3967734 -
CM017705.1chromosomeCM017705.1:3790842..3791038 -
Chr09chromosomeBNL3452:1..566 .
Chr09:3512741..3513296 -
Chr9chromosomeBNL3452:1..566 .
Chr9:3092204..3092759 +
Sequence
>BNL3452 ID=BNL3452|Name=BNL3452|organism=Gossypium hirsutum|type=genetic_marker|length=191bp
TGTAACTGAGCAGCCGTACGTTCTTCATGATAGAAATTCATTCCATGATT
TGATTTGTTCGACGATGGACACACACACACACACACACACACACATATAT
AATATAATACACTGTAACTTTTGGGAAGGTTTCCTGTGCTGGTCGACAGC
TGGAATTGAACACCGCAACAGGGATCTCACTCTGCTTTGGC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D05-1N/AAD_chr.1918.9BNL3452
27235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A10N/AAD_chr.1018.6BNL3452
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr19N/AAD_chr.19207.59BNL3452
4Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr19/lgD08N/AAD_chr.1931.5BNL3452
5Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr19/lgD08N/AAD_chr.1913.1BNL3452
6Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c19N/AAD_chr.1925.73BNL3452
7Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch19/lgD08N/AAD_chr.198.09BNL3452
8Hai-7124 x Junmian-1, BC1 (2008) partHai-7124 x Junmian-1, BC1 (2008) part.HJ-BC1_chr19N/AAD_chr.1996.5BNL3452
9Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr19/lgD08N/AAD_chr.1933BNL3452
10Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr19/lgD08N/AAD_chr.1926.5BNL3452
11AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.1960BNL3452
12AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.0516BNL3452
13TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.19/D08N/AAD_chr.1919.6BNL3452
14Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg1/chr19N/AAD_chr.19320.6BNL3452
15Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-1N/AAD_chr.053BNL3452
16CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_D08N/AAD_chr.19196.4BNL3452
177235 x TM-1, F2:3 (2005)7T-F2:3_chr10N/AAD_chr.100BNL3452
18Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr19-1N/AAD_chr.1914.7BNL3452
19TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr05-2N/AAD_chr.0528.6BNL3452
20CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr19N/ADt.05196BNL3452
21Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr05N/AAD_chr.05190BNL3452a
22TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.0522.74BNL3452a
23TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.05180.2BNL3452a
24Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr19N/AAD_chr.19230BNL3452b
25TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c19N/AAD_chr.1922.59BNL3452b
26TM-1 x 3-79, RIL (2014)T3-RIL.14_chr19N/AAD_chr.19160.2BNL3452b
27TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.0529.2BNL3452-170
28TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.0526.14BNL3452-170
29TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr19N/AAD_chr.1923.7BNL3452-180
30TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr19/D5N/AAD_chr.1923.5BNL3452-180
31Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD08.1N/AAD_chr.190BNL3452-180
32TM-1 x Hai-7124, BC1 (2005.v0)TH-RIL_chr19/lgD08N/AAD_chr.1915.7BNL3452-180
33Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD08.2N/AAD_chr.1926.1BNL3452-195
34TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.05180.21BNL3452a
35TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.19N/AAD_chr.19160.17BNL3452b
36MGG-293-793, MAGIC (2018)MAGIC-19831_chr19N/AAD_chr.19214.1BNL3452