BNL3279, BNL3279 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL3279
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL3279_orig
Source Typegenomic
Repeat Motif(AG)15
PCR ConditionAnnealing temperature: 55
Primer 1BNL3279_F: CATGTCCAATGGATGTGTCA
Primer 2BNL3279_R: GGGCCACTTAAAGGCATTCT
PolymorphismP_ BNL3279
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL3279_FBNL3279_FGossypium hirsutumprimer
BNL3279_RBNL3279_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TTT-CSIL_ch03.nj13.2Gossypium hirsutumQTL
lint percentqLP.TTT-CSIL_ch03.nj13.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3279BNL3279Gossypium hirsutummarker_locus
BNL3279-120BNL3279-120Gossypium hirsutummarker_locus
BNL3279/120y(C21)BNL3279/120y(C21)Gossypium hirsutummarker_locus
BNL3279_106BNL3279_106Gossypium hirsutummarker_locus
BNL3279aBNL3279aGossypium hirsutummarker_locus
BNL3279bBNL3279bGossypium hirsutummarker_locus
BNL3278BNL3278Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3279_origBNL3279_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D11chromosomeD11:65886069..65886194 +
A11chromosomeA11:108314673..108314788 -
CM018212.1chromosomeCM018212.1:108029699..108029814 +
D5_11chromosomeD5_11:4540840..4540955 +
Chr10chromosomeChr10:74030409..74030524 -
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:6308843..6308958 -
Chr7chromosomeChr7:5702866..5702981 +
D10_11chromosomeD10_11:63147213..63147338 -
CM016624.1chromosomeCM016624.1:137112226..137112345 -
At_chr1chromosomeAt_chr1:2512654..2512769 +
D11chromosomeD11:59769332..59769457 +
A11chromosomeA11:87135966..87136081 -
Ghir_D11chromosomeGhir_D11:66713683..66713808 -
Ghir_A11chromosomeGhir_A11:117226814..117226929 -
D11chromosomeD11:65561459..65561584 -
A11chromosomeA11:115530746..115530861 -
A11chromosomeA11:113358759..113358874 -
D11chromosomeD11:63457177..63457302 -
A11chromosomeA11:110140876..110140991 -
Dt11chromosomeDt11:62334215..62334322 +
scaffold6985supercontigscaffold6985:50787..50902 +
scaffold31745supercontigscaffold31745:7000..7107 +
Gbar_D11chromosomeGbar_D11:63498657..63498764 -
Gbar_A11chromosomeGbar_A11:107352588..107352703 -
A11chromosomeA11:110252298..110252413 -
CM017620.1chromosomeCM017620.1:112483977..112484092 +
CM017633.1chromosomeCM017633.1:65643649..65643770 -
CM017659.1chromosomeCM017659.1:67627498..67627619 -
CM017646.1chromosomeCM017646.1:120573712..120573827 -
CM017698.1chromosomeCM017698.1:108102268..108102383 +
Chr07chromosomeBNL3279:1..619 .
Chr07:56142481..56143089 -
Chr7chromosomeBNL3279:1..619 .
Chr7:5702866..5703474 +
Sequence
>BNL3279 ID=BNL3279|Name=BNL3279|organism=Gossypium hirsutum|type=genetic_marker|length=126bp
CATGTCCAATGGATGTGTCATTAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGTACCTCGAATCACCAACAAAATCATTAGAGACAACATCTTCTTCTGTG
TATCCAAGAATGCCTTTAAGTGGCCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Acala-44 x Pima S-7, F2 (2004)Acala-44 x Pima S-7, F2 (2004).AP-F2_lg24/chr20N/AAD_chr.2022.9BNL3279
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr09N/AAD_chr.09193.6BNL3279
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr21N/AAD_chr.21214.26BNL3279
4Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr21/lgD02N/AAD_chr.2135.3BNL3279
5Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.2132.93BNL3279
6Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch21/lgD02N/AAD_chr.2117.3BNL3279
7Hai-7124 x Junmian-1, BC1 (2008) partHai-7124 x Junmian-1, BC1 (2008) part.HJ-BC1_chr21N/AAD_chr.2129.9BNL3279
8Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr21N/AAD_chr.21130BNL3279
9AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.0915BNL3279
10Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg2N/AAD_unknown198BNL3279
11Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.3N/AAD_chr.052.8BNL3279
12Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr21N/AAD_chr.214.5BNL3279
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.2132BNL3279
14Yumian-1 x T586, RIL (2006)YT-RIL_chr21-1N/AAD_chr.2110.2BNL3279
15Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-3N/AAD_chr.052.8BNL3279
16NemX x SJ-2, RIL (2005)NS-RIL_chr11/lgA03N/AAD_chr.11158.6BNL3279
17Yumian-1 x T586, RIL (2015)YT-RIL.15_chr21N/AAD_chr.21155.6BNL3279
18W10 x TM-1, F2:3 (2015)WT-F2:3_chr21N/AAD_chr.2121.2BNL3279
19CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr11N/AAt.11141BNL3279
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr21N/AAD_chr.2139.5BNL3279-120
21TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr21/D11N/AAD_chr.2131.8BNL3279-120
22Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD02N/AAD_chr.2137.8BNL3279-120
23Yumian-1 x T586, RIL (2009)YT-RIL_chr21N/AAD_chr.214.3BNL3279/120y(C21)
24GB713 x Nem-X, F2 (2011)GN-F2_chr21N/AAD_chr.21184.5BNL3279_106
25TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr03N/AAD_chr.0333.3BNL3279a
26TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr21N/AAD_chr.21143.4BNL3279b
27Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr21N/AAD_chr.21203.2BNL3278
Image
File NameLegend
CRS-49-1151_F3_poly.jpgPolymorphisms of BNL1066 and BNL3279 on a reniform nematode resistance trait-association panel. [Image from Dighe et al., 2009, CRS-49-1151]
CRS-49-1151_F5_poly.jpgPolymorphisms of BNL1066 and BNL3279 on a reniform nematode resistance DNA panel. [Image from Dighe et al., 2009, CRS-49-1151]