BNL3259, BNL3259 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL3259
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL3259_orig
Source Typegenomic
Repeat Motif(AC)11
PCR ConditionAnnealing temperature: 55
Primer 1BNL3259_F: TTTTGAAATTCCAGCGAAGG
Primer 2BNL3259_R: GTCAATACCTGCTTCTCCACG
PolymorphismP_ BNL3259
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL3259_FBNL3259_FGossypium hirsutumprimer
BNL3259_RBNL3259_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed number per bollqSNPB.HP-ch3.2Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3259aBNL3259aGossypium hirsutummarker_locus
BNL3259bBNL3259bGossypium hirsutummarker_locus
BNL3259BNL3259Gossypium hirsutummarker_locus
BNL3259-200BNL3259-200Gossypium hirsutummarker_locus
BNL3259-210BNL3259-210Gossypium hirsutummarker_locus
BNL3259-295BNL3259-295Gossypium hirsutummarker_locus
BNL3259-225BNL3259-225Gossypium hirsutummarker_locus
BNL3259-222BNL3259-222Gossypium hirsutummarker_locus
BNL3259-205BNL3259-205Gossypium hirsutummarker_locus
BNL3259-227BNL3259-227Gossypium hirsutummarker_locus
BML3259BML3259Gossypium hirsutummarker_locus
BNL3259(C3,C14)BNL3259(C3,C14)Gossypium hirsutummarker_locus
BNL3259BNL3259-127.291Gossypium hirsutummarker_locus
BNL3259bBNL3259b-95.781Gossypium hirsutummarker_locus
BNL3259aBNL3259a-97.049Gossypium hirsutummarker_locus
BNL3259BNL3259-40.9Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3259_origBNL3259_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:68047607..68047810 +
A03chromosomeA03:105688615..105688824 +
CM018216.1chromosomeCM018216.1:64398181..64398398 +
D5_03chromosomeD5_03:2548338..2548557 -
KI_03chromosomeKI_03:39758162..39758383 +
Chr8chromosomeChr8:39275849..39276064 -
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:132723191..132723406 +
Chr10chromosomeChr10:4322126..4322345 +
D10_03chromosomeD10_03:2484837..2485046 -
CM016616.1chromosomeCM016616.1:3494950..3495147 -
Dt_chr5chromosomeDt_chr5:9848526..9848729 +
scaffold1147.1supercontigscaffold1147.1:541937..542146 -
D02chromosomeD02:64670518..64670721 +
A03chromosomeA03:97427110..97427319 +
Ghir_D02chromosomeGhir_D02:67145013..67145216 +
Ghir_A03chromosomeGhir_A03:110075714..110075923 +
D02chromosomeD02:67181520..67181723 +
A03chromosomeA03:108753777..108753986 +
D02chromosomeD02:68470118..68470321 +
A03chromosomeA03:107182927..107183136 +
D02chromosomeD02:65584287..65584492 +
A03chromosomeA03:102458213..102458422 +
A03chromosomeA03:102434244..102434453 +
scaffold10232supercontigscaffold10232:169607..170412 +
Gbar_D02chromosomeGbar_D02:64999764..64999983 +
Gbar_A03chromosomeGbar_A03:102374500..102374727 +
D02chromosomeD02:66216502..66216723 +
A03chromosomeA03:104705242..104705471 +
CM017624.1chromosomeCM017624.1:67304022..67304249 +
CM017612.1chromosomeCM017612.1:104080773..104080982 +
CM017650.1chromosomeCM017650.1:68925533..68925744 +
CM017638.1chromosomeCM017638.1:111196570..111196771 +
CM017702.1chromosomeCM017702.1:65814166..65814385 +
CM017690.1chromosomeCM017690.1:105188573..105188796 +
Chr10chromosomeBNL3259:9..530 .
Chr10:4321824..4322356 +
Chr05chromosomeBNL3259:9..530 .
Chr05:61607204..61607736 +
Sequence
>BNL3259 ID=BNL3259|Name=BNL3259|organism=Gossypium hirsutum|type=genetic_marker|length=210bp
TTTTGAAATTCCAGCGAAGGGAGAGGAGACACACACACACACACACACAC
AGAGATCTTCAAATTTCATCAATGGATCATTCAAAGGTTCAAGAGGTAAC
TTCAATGATAAACCCTTAAGCTTTCCATTTTGGATCTTTAATTTGTCTTC
TGAATTTATTTATATAAATATTTCGATTCTTGTCCAGATCGTGGAGAAGC
AGGTATTGAC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr03N/AAD_chr.0373.3BNL3259a
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr03N/AAD_chr.03109.2BNL3259a
3Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr14N/AAD_chr.14136.7BNL3259a
4Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr14N/AAD_chr.1450BNL3259a
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.1429.37BNL3259a
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.1497BNL3259a
7CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr14N/AAD_chr.14167BNL3259b
8Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr14N/AAD_chr.14160.6BNL3259b
9Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr03N/AAD_chr.0396.9BNL3259b
10TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0320.59BNL3259b
11TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0395.8BNL3259b
12Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c14N/AAD_chr.1499.62BNL3259
13Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c03N/AAD_chr.0391.2BNL3259
14Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch14N/AAD_chr.1481.01BNL3259
15Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch03N/AAD_chr.0361.12BNL3259
16AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr14N/AAD_chr.14188BNL3259
17Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg25N/AAD_unknown22.3BNL3259
18Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_A02/D03N/AAD_chr.0811BNL3259
19Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_A02/D03N/AAD_chr.2411BNL3259
20Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr03N/AAD_chr.03154.7BNL3259
21AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03184BNL3259
22(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr14-2N/AAD_chr.1445.1BNL3259
23T582 x Hai-7124, F2 (2010)T5H-F2_chr3N/AAD_chr.030BNL3259
24Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.14139.6BNL3259
25Yumian-1 x 7235, RIL (2015)Y7-RIL_chr14N/AAD_chr.1491.9BNL3259
26DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr14-1N/AAD_chr.1451.84BNL3259
27DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr14-1N/AAD_chr.14-19.9BNL3259
28SG 747 x Giza 75, BIL (2013)SG-BIL_chr03N/AAD_chr.0316.9BNL3259
29CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr14N/AAD_chr.1415.4BNL3259
30HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr14N/AAD_chr.1450BNL3259-200
31TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.030BNL3259-210
32Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr03N/AAD_chr.03115.4BNL3259-210
33TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.0324.3BNL3259-295
34TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.0325.48BNL3259-295
35Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr03N/AAD_chr.03110BNL3259-225
36Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr14N/AAD_chr.14115.8BNL3259-222
37Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr14N/AAD_chr.14119.6BNL3259-205
38Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr14N/AAD_chr.14157.3BNL3259-227
39Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch14/D2-2N/AN/A0BML3259
40Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr08N/AAD_chr.0811BNL3259(C3,C14)
41Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr24N/AAD_chr.2411BNL3259(C3,C14)
42CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr14N/ADt.02127.29BNL3259
43TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0395.78BNL3259b
44TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.1497.05BNL3259a
45PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr14N/ADt.0240.9BNL3259
Image
File NameLegend
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]