BNL3089, BNL3089 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL3089
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL3089_orig
Source Typegenomic
Repeat Motif(AG)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL3089_F: TCGAACTTAACAAAAGAGAGAGAGA
Primer 2BNL3089_R: AAATCCGGATTCAGCAATACTT
PolymorphismP_ BNL3089
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL3089_FBNL3089_FGossypium hirsutumprimer
BNL3089_RBNL3089_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.MAGIC-19831_ch04.hg13Gossypium spp.QTL
micronaireqMIC.MAGIC-19831_ch04.zk15Gossypium spp.QTL
micronaireqMIC.MAGIC-19831_ch04.jz15Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3089BNL3089Gossypium hirsutummarker_locus
BNL3089-125BNL3089-125Gossypium hirsutummarker_locus
BNL3089BNL3089-1.639Gossypium hirsutummarker_locus
BNL3089BNL3089-15.198Gossypium hirsutummarker_locus
BNL3089BNL3089-136.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3089_origBNL3089_origGossypium hirsutumsequence_feature


Sequence
>BNL3089 ID=BNL3089|Name=BNL3089|organism=Gossypium hirsutum|type=genetic_marker|length=131bp
TCGAACTTAACAAAAGAGAGAGAGAGAGAGAGAGAATAGAAGCCAAATTG
ATTGAAAAAAATGTAAACCTTCACAACTATGCTTTGATTTATGGATCTAT
TAGAGGCCTAAGTATTGCTGAATCCGGATTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr04N/AAD_chr.04160BNL3089View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c04N/AAD_chr.0413.66BNL3089View
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr04N/AAD_chr.04137.25BNL3089View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr24N/AAD_chr.2435BNL3089View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr04-1N/AAD_chr.040BNL3089View
6DH962 x Jinmian-6, F2 (2009)DJ-F2_chr04N/AAD_chr.040BNL3089View
7DH962 x Jinmian-6, F2 (2009)DJ-F2_chr04/LG13N/AAD_chr.040BNL3089View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr22N/AAD_chr.22114BNL3089View
9DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr04N/AAD_chr.0479.86BNL3089View
10TM-1 x 3-79, RIL (2014)T3-RIL.14_chr04N/AAD_chr.0415.2BNL3089View
11W10 x TM-1, F2:3 (2015)WT-F2:3_chr04-2N/AAD_chr.040BNL3089View
12DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr04N/AAD_chr.0482.2BNL3089View
13SG 747 x Giza 75, BIL (2013)SG-BIL_chr04N/AAD_chr.040BNL3089View
14CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr04N/AAD_chr.0477.8BNL3089View
15TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr04N/AAD_chr.040BNL3089-125View
16TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr04/A4N/AAD_chr.043.54BNL3089-125View
17Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD03N/AAD_chr.24143.3BNL3089-125View
18CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr04N/AAt.041.64BNL3089View
19TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.04N/AAD_chr.0415.2BNL3089View
20MGG-293-793, MAGIC (2018)MAGIC-19831_chr04N/AAD_chr.04136.3BNL3089View