BNL2960, BNL2960 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2960
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2960_orig
Source Typegenomic
Repeat Motif(GA)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL2960_F: TAAGCTCTGGAGGCCAAAAA
Primer 2BNL2960_R: CCATTTCAATTTCAAGCATACG
PolymorphismP_ BNL2960
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2960_FBNL2960_FGossypium hirsutumprimer
BNL2960_RBNL2960_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.GG-F2_ch10.cz08.1Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-F2_ch10.hd08Gossypium hirsutumQTL


This genetic_marker is contained in the following chromosome_arm feature(s):

Feature NameUnique NameSpeciesType
10 Long10 LongGossypium hirsutumchromosome_arm


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.TSP-BNL2960Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2960BNL2960Gossypium hirsutummarker_locus
BNL2960-148BNL2960-148Gossypium hirsutummarker_locus
BNL2960-180BNL2960-180Gossypium hirsutummarker_locus
BNL2960/160y(C10)BNL2960/160y(C10)Gossypium hirsutummarker_locus
BNL2960BNL2960-109.728Gossypium hirsutummarker_locus
BNL2960BNL2960-44.79Gossypium hirsutummarker_locus
BNL2960BNL2960-112Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2960_origBNL2960_origGossypium hirsutumsequence_feature


Sequence
>BNL2960 ID=BNL2960|Name=BNL2960|organism=Gossypium hirsutum|type=genetic_marker|length=154bp
TAAGCTCTGGAGGCCAAAAAGAATATGAATGAGTCCNTAGACGAGAGAGA
GAGAGAGAGAGAATTGAAGTGTGAGTTGAAAGATTATGGCATTTATTGAA
ATTGAGGATTGAGTATCATATTAGTCTATGCACGTATGCTTGAAATTGAA
ATGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr10N/AAD_chr.1061.5BNL2960
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr10N/AAD_chr.10134BNL2960
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c10N/AAD_chr.10114.03BNL2960
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch10N/AAD_chr.1041.59BNL2960
5Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr10N/AAD_chr.10142.6BNL2960
6Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr10N/AAD_chr.1050BNL2960
7TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.10bN/AAD_chr.1019.2BNL2960
83-79 x NM24016, RIL (2008)3-79 x NM24016, RIL (2008).3N-RIL_chr10-2N/AAD_chr.1048.9BNL2960
9Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr10N/AAD_chr.10130.9BNL2960
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr10N/AAD_chr.10187BNL2960
11TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c10N/AAD_chr.1040.73BNL2960
12Yumian-1 x T586, RIL (2006)YT-RIL_chr10-2N/AAD_chr.10131.3BNL2960
13Yumian-1 x T586, RIL (2015)YT-RIL.15_chr10N/AAD_chr.1088.7BNL2960
14TM-1 x 3-79, RIL (2014)T3-RIL.14_chr10N/AAD_chr.1044.8BNL2960
15GX1135 x GX100-2, F2 (2013)GG-F2_chr10N/AAD_chr.1065.6BNL2960
16GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr10N/AAD_chr.100BNL2960
17GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr10N/AAD_chr.100BNL2960
18CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr10N/AAt.1046.7BNL2960
19SG 747 x Giza 75, BIL (2013)SG-BIL_chr10N/AAD_chr.1058.3BNL2960
20CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr10N/AAD_chr.1088.1BNL2960
21HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr10N/AAD_chr.1026BNL2960-148
22TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr10N/AAD_chr.1068.8BNL2960-180
23TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr10/A10N/AAD_chr.1079.99BNL2960-180
24Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr10N/AAD_chr.10158.4BNL2960-180
25Yumian-1 x T586, RIL (2009)YT-RIL_chr10-1N/AAD_chr.10131.3BNL2960/160y(C10)
26CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr10N/AAt.10109.73BNL2960
27TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.10N/AAD_chr.1044.79BNL2960
28PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr10N/AAt.10112BNL2960
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]