BNL2877, BNL2877 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2877
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2877_orig
Source Typegenomic
Repeat Motif(TC)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL2877_F: TCGATCCCTTTTCTCTCTCTCTC
Primer 2BNL2877_R: TTGACTCGGCAGATTGACAAA
PolymorphismP_ BNL2877
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2877_FBNL2877_FGossypium hirsutumprimer
BNL2877_RBNL2877_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2877BNL2877Gossypium hirsutummarker_locus
BNL2877-110BNL2877-110Gossypium hirsutummarker_locus
BNL2877BNL2877-71.4Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2877_origBNL2877_origGossypium hirsutumsequence_feature


Sequence
>BNL2877 ID=BNL2877|Name=BNL2877|organism=Gossypium hirsutum|type=genetic_marker|length=114bp
TCGATCCCTTTTCTCTCTCTCTCTCTCTCTCTTTTTGTTTTGGATTGTAG
GGTTTTCATTCGTCGCTAAAGTTTTTTATGTTGGAAGTTGAAATTTGTCA
ATCTGCCGAGTCAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.022.86BNL2877View
2Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0290BNL2877View
3Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg6/chr02N/AAD_chr.020BNL2877View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.02183BNL2877View
5W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.0245.3BNL2877View
6GX1135 x GX100-2, F2 (2013)GG-F2_chr11-2N/AAD_chr.1170.9BNL2877View
7GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-2N/AAD_chr.020BNL2877View
8GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-2N/AAD_chr.020BNL2877View
9HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr02N/AAD_chr.0226BNL2877-110View
10PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr02-1N/AAt.0271.4BNL2877-71.4View