BNL2827, BNL2827 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2827
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2827_orig
Source Typegenomic
Repeat Motif(GA)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL2827_F: ATCGCGGGCATTAATGAATA
Primer 2BNL2827_R: AATACATCCGCTCATTTCGC
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2827_FBNL2827_FGossypium hirsutumprimer
BNL2827_RBNL2827_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.DJiM-RIL_ch15-1.j08Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2827*BNL2827*Gossypium hirsutummarker_locus
BNL2827BNL2827Gossypium hirsutummarker_locus
BNL2827/120t(C1)BNL2827/120t(C1)Gossypium hirsutummarker_locus
BNL2827bBNL2827bGossypium hirsutummarker_locus
BNL2827aBNL2827aGossypium hirsutummarker_locus
BNL2827BNL2827-50.912Gossypium hirsutummarker_locus
BNL2827BNL2827-90.148Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2827_origBNL2827_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:14842266..14842450 -
A01chromosomeA01:19788414..19788592 -
CM018215.1chromosomeCM018215.1:14627272..14627456 -
CM018202.1chromosomeCM018202.1:18037928..18038110 -
D5_01chromosomeD5_01:14018717..14018900 -
Chr7chromosomeChr7:88234198..88234373 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:20077014..20077189 -
Chr2chromosomeChr2:36862755..36862939 +
D10_01chromosomeD10_01:46176304..46176480 +
CM016614.1chromosomeCM016614.1:27115633..27115809 -
Dt_chr2chromosomeDt_chr2:42443589..42443767 -
At_chr2chromosomeAt_chr2:16716808..16716986 -
D01chromosomeD01:13703871..13704055 -
A01chromosomeA01:18462265..18462443 -
Ghir_D01chromosomeGhir_D01:15125820..15126004 -
Ghir_A01chromosomeGhir_A01:19052053..19052231 -
D01chromosomeD01:14798042..14798226 -
A01chromosomeA01:18477380..18477558 -
D01chromosomeD01:14651889..14652067 -
A01chromosomeA01:18931687..18931865 -
D01chromosomeD01:15018978..15019162 -
A01chromosomeA01:19532545..19532723 -
scaffold12297supercontigscaffold12297:116512..116692 +
scaffold14722supercontigscaffold14722:63218..63398 -
Gbar_D01chromosomeGbar_D01:15225645..15225829 -
Gbar_A01chromosomeGbar_A01:18185327..18185509 -
D01chromosomeD01:15002387..15002573 -
A01chromosomeA01:18021788..18021970 -
CM017623.1chromosomeCM017623.1:14882247..14882431 -
CM017610.1chromosomeCM017610.1:19485826..19486008 -
CM017649.1chromosomeCM017649.1:15726826..15727009 -
CM017636.1chromosomeCM017636.1:18655092..18655274 -
CM017701.1chromosomeCM017701.1:15016651..15016837 -
CM017688.1chromosomeCM017688.1:18231863..18232045 -
Chr2chromosomeBNL2827:1..456 .
Chr2:36862621..36863082 +
Sequence
>BNL2827 ID=BNL2827|Name=BNL2827|organism=Gossypium hirsutum|type=genetic_marker|length=179bp
ATCGCGGGCATTAATGAATACAGAACAAAGACATGATGACTCTGCTTACT
AAGTATTCACAAGCCCACAACAAACGCGCTAAGTAATTGTATGAAAGAGT
GCGAGAGAGAGAGAGAGAGAGACCTTGACAATGTTAACGGGAATGTTCTC
CCCAGTTTGGCGAAATGAGCGGATGTATT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr01N/AAD_chr.0150.1BNL2827*
2Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.01110BNL2827
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0163BNL2827
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.0154.23BNL2827
5Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg23/chr01N/AAD_chr.0112.6BNL2827
6Yumian-1 x T586, RIL (2006)YT-RIL_chr15-3N/AAD_chr.1529.2BNL2827
7(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr15-2N/AAD_chr.15126.2BNL2827
8DH962 x Jinmian-6, F2 (2009)DJ-F2_chr15N/AAD_chr.1537.4BNL2827
9DH962 x Jinmian-6, F2 (2009)DJ-F2_chr15/LG14N/AAD_chr.1537.4BNL2827
10Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.1550.2BNL2827
11DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0143.84BNL2827
12DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1543.84BNL2827
13TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.0190.1BNL2827
14GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.0148.2BNL2827
15DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15-1N/AAD_chr.15-143.2BNL2827
16Yumian-1 x T586, RIL (2009)YT-RIL_chr15-1N/AAD_chr.1529.2BNL2827/120t(C1)
17GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.01103.1BNL2827b
18GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.01103.8BNL2827a
19CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0150.91BNL2827
20TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.0190.15BNL2827