BNL2805, BNL2805 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2805
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2805_orig
Source Typegenomic
Repeat Motif(GA)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL2805_F: AGTTTGGAATTACAATAAATGTACTCG
Primer 2BNL2805_R: CCAAGGTCGGTCGGTTACTA
PolymorphismP_ BNL2805
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2805_FBNL2805_FGossypium hirsutumprimer
BNL2805_RBNL2805_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2805BNL2805Gossypium hirsutummarker_locus
BNL2805-255BNL2805-255Gossypium hirsutummarker_locus
BNL2805-217BNL2805-217Gossypium hirsutummarker_locus
BNL2805aBNL2805aGossypium hirsutummarker_locus
BNL2805bBNL2805bGossypium hirsutummarker_locus
BNL2805/210y(C11,C21)BNL2805/210y(C11,C21)Gossypium hirsutummarker_locus
BNL2805_217BNL2805_217Gossypium hirsutummarker_locus
BNL2805BNL2805-102.593Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2805_origBNL2805_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D11chromosomeD11:30490236..30490450 +
A11chromosomeA11:56285279..56285512 -
CM018225.1chromosomeCM018225.1:29110948..29111162 +
CM018212.1chromosomeCM018212.1:54280088..54280328 -
Chr4chromosomeChr4:114833167..114833398 +
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:79349061..79349292 -
D10_11chromosomeD10_11:28938158..28938388 +
CM016624.1chromosomeCM016624.1:50505427..50505644 -
Dt_chr7chromosomeDt_chr7:31443103..31443317 +
At_chr1chromosomeAt_chr1:77155860..77156093 +
scaffold45126supercontigscaffold45126:385..599 +
A11chromosomeA11:49637579..49637812 -
Ghir_D11chromosomeGhir_D11:29879901..29880115 +
Ghir_A11chromosomeGhir_A11:58872379..58872612 -
D11chromosomeD11:29168376..29168590 +
A11chromosomeA11:56654727..56654960 -
D11chromosomeD11:29975305..29975519 +
A11chromosomeA11:57131488..57131721 -
D11chromosomeD11:29711259..29711473 +
A11chromosomeA11:56008784..56009017 -
Dt11chromosomeDt11:32717056..32717273 +
Dt11chromosomeDt11:32723982..32724196 +
At11chromosomeAt11:53806493..53806733 -
At11chromosomeAt11:53814579..53814796 -
scaffold9117supercontigscaffold9117:143643..143860 +
scaffold9117supercontigscaffold9117:150569..150783 +
scaffold4748supercontigscaffold4748:55045..55285 -
scaffold4748supercontigscaffold4748:63131..63348 -
Gbar_D11chromosomeGbar_D11:29412166..29412380 +
Gbar_A11chromosomeGbar_A11:53901728..53901968 -
D11chromosomeD11:29268338..29268550 +
A11chromosomeA11:54429945..54430185 -
CM017633.1chromosomeCM017633.1:29294745..29294959 +
CM017620.1chromosomeCM017620.1:57224559..57224801 -
CM017659.1chromosomeCM017659.1:29773987..29774201 +
CM017646.1chromosomeCM017646.1:59841101..59841337 -
CM017711.1chromosomeCM017711.1:29296200..29296414 +
CM017698.1chromosomeCM017698.1:54918465..54918701 -
Sequence
>BNL2805 ID=BNL2805|Name=BNL2805|organism=Gossypium hirsutum|type=genetic_marker|length=234bp
AGTTTGGAATTACAATAAATGTACTCGGTCTGATAATTTACGAGAGAGAG
AGAGAGAGAGATGAGATTTAAAAGGACAAAAATAAAAAAAGTTGGTTATT
GGCGAANGTTACTGGTAAACTGGCAAGTGGAGGTTCTTACTTGTTTACTT
ATTACAGAACAGTAACAAGTCAACGGTTTGGCATGCAACGTTTACACCTT
AATTGTTAATTTTGTAGTAACCGACCGACCTTGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A03N/AAD_chr.11119.8BNL2805
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c11N/AAD_chr.1186.49BNL2805
3Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch11/lgA03N/AAD_chr.1140.12BNL2805
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch21/lgD02N/AAD_chr.2162.32BNL2805
5Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr11/lgA03N/AAD_chr.11233.4BNL2805
6Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr11N/AAD_chr.11110BNL2805
7Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr21/lgD02N/AAD_chr.2171.4BNL2805
8AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.1172BNL2805
9Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr11.2N/AAD_chr.111.5BNL2805
10Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr11N/AAD_chr.1198.33BNL2805
11Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.2178.06BNL2805
12AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.2148BNL2805
13TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c11N/AAD_chr.1199.39BNL2805
14Yumian-1 x T586, RIL (2006)YT-RIL_chr11-3N/AAD_chr.1156.6BNL2805
15Yumian-1 x T586, RIL (2015)YT-RIL.15_chr11N/AAD_chr.1176.4BNL2805
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr11N/AAD_chr.11102.6BNL2805
17Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.11N/AAD_chr.110BNL2805-255
18Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.21N/AAD_chr.2116.4BNL2805-217
19Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr11/lgA03N/AAD_chr.11100.1BNL2805a
20Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr21/lgD02N/AAD_chr.21113.6BNL2805b
21Yumian-1 x T586, RIL (2009)YT-RIL_chr11-2N/AAD_chr.1156BNL2805/210y(C11,C21)
22GB713 x Nem-X, F2 (2011)GN-F2_chr21N/AAD_chr.21143.7BNL2805_217
23TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.11N/AAD_chr.11102.59BNL2805