BNL2742, BNL2742 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2742
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2742_orig
Source Typegenomic
Repeat Motif(AG)11
PCR ConditionAnnealing temperature: 55
Primer 1BNL2742_F: GACGCCATCCTCAACATTTT
Primer 2BNL2742_R: CGTGATCCCAGAGGAGAAAA
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2742_FBNL2742_FGossypium hirsutumprimer
BNL2742_RBNL2742_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2742BNL2742Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2742_origBNL2742_origGossypium hirsutumsequence_feature


Sequence
>BNL2742 ID=BNL2742|Name=BNL2742|organism=Gossypium hirsutum|type=genetic_marker|length=214bp
GACGCCATCCTCAACATTTTCACTGAGTTAGGGCTTGGATTTGGGAACTT
TGATTGGTTGTACGCAGATATATATATCTAGAGAGAGAGAGAGAGAGAGA
GCGCGCTTGGAGAGACGGCTATACGGGACGCGTGGGAGGGTGAAAACAGA
TTCTGGAGTTTCCTCTGTAAGATAGAACCAACACGCGTCAGAGTTTTTCT
CCTCTGGGATCACG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr17N/AAD_chr.17112BNL2742View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr17N/AAD_chr.1780.99BNL2742View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr17N/AAD_chr.1738.7BNL2742View
4W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.02117.1BNL2742View