BNL2652, BNL2652 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2652
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2652_orig
Source Typegenomic
Repeat Motif(TC)32
PCR ConditionAnnealing temperature: 55
Primer 1BNL2652_F: TTCATCATTCTAGCCTGAGTCC
Primer 2BNL2652_R: GCGATAATCCTTCCAGGGAT
PolymorphismP_ BNL2652
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2652_FBNL2652_FGossypium hirsutumprimer
BNL2652_RBNL2652_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
2.5 span lengthqSL2.5.T3-ch18.2Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2652BNL2652Gossypium hirsutummarker_locus
BNL2652bBNL2652bGossypium hirsutummarker_locus
BNL2652aBNL2652aGossypium hirsutummarker_locus
BNL2652cBNL2652cGossypium hirsutummarker_locus
BNL2652dBNL2652dGossypium hirsutummarker_locus
BNL2652-190BNL2652-190Gossypium hirsutummarker_locus
BNL2652-195BNL2652-195Gossypium hirsutummarker_locus
BNL2652BNL2652-39.502Gossypium hirsutummarker_locus
BNL2652aBNL2652a-105.3Gossypium hirsutummarker_locus
BNL2652bBNL2652b-185.5Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2652_origBNL2652_origGossypium hirsutumsequence_feature


Sequence
>BNL2652 ID=BNL2652|Name=BNL2652|organism=Gossypium hirsutum|type=genetic_marker|length=225bp
TTCATCATTCTAGCCTGAGTCCTTCCANCTCTCTCTCTCTCTCTCTCTCT
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGTAGATATG
TTTTCTTGCACACATAAGACAACAAGTATACCTTTGATCAAGGTTGTTAG
TGGTACGATAAGATAATAACTGATAGTTTTCCAATAACTACCTTACCGGN
TCCTTATCCCTGGAAGGATTATCGC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr18N/AAD_chr.1877BNL2652
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.1394.51BNL2652
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c18N/AAD_chr.1890.97BNL2652
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch13/lgA01N/AAD_chr.1341.51BNL2652
5Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr13/lgA01N/AAD_chr.1332BNL2652
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.1847BNL2652
7TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.18bN/AAD_chr.18101.9BNL2652
8TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c18N/AAD_chr.1838.29BNL2652
9Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg10/chr18N/AAD_chr.1886BNL2652
10Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr18N/AAD_chr.1891.41BNL2652
11Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch18N/AAD_chr.1870.59BNL2652
12AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13156BNL2652
13H18 x 3-79, F2 (2005)H18P379-F2_chr18N/AAD_chr.1837.2BNL2652
14H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.1364.2BNL2652
15TM-1 x 3-79, RIL (2014)T3-RIL.14_chr18N/AAD_chr.1839.5BNL2652
16TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr18N/AAD_chr.1830.6BNL2652
17CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.1397.1BNL2652
18CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr18N/ADt.1345.3BNL2652
19Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.13149.7BNL2652b
20Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr13/lgA01N/AAD_chr.1332.4BNL2652b
21Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr18N/AAD_chr.1890BNL2652b
22Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr18N/AAD_chr.1848.9BNL2652b
23SG 747 x Giza 75, BIL (2013)SG-BIL_chr13N/AAD_chr.1344.4BNL2652b
24Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.1390BNL2652a
25Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr18N/AAD_chr.18109.7BNL2652a
26Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr13/lgA01N/AAD_chr.13100.9BNL2652a
27SG 747 x Giza 75, BIL (2013)SG-BIL_chr18N/AAD_chr.1862.9BNL2652a
28Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr18N/AAD_chr.180BNL2652c
29Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr18N/AAD_chr.1822.1BNL2652d
30TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1369.4BNL2652-190
31TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1369.3BNL2652-190
32Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr18N/AAD_chr.1863.5BNL2652-195
33TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr18N/AAD_chr.1873.9BNL2652-195
34TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr18/D13N/AAD_chr.1874.41BNL2652-195
35TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.18N/AAD_chr.1839.5BNL2652
36PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr13N/AAt.13105.3BNL2652a
37PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr18N/ADt.13185.5BNL2652b