BNL2530, BNL2530 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2530
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2530_orig
Source Typegenomic
Repeat Motif(GA)9+G2+(GA)2, (CT)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL2530_F: CACGTCGTTTTGGAGGCTAT
Primer 2BNL2530_R: TTTTGAAATTTCTGGCCACC
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2530_FBNL2530_FGossypium hirsutumprimer
BNL2530_RBNL2530_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2530BNL2530Gossypium hirsutummarker_locus
BNL2530-155BNL2530-155Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2530_origBNL2530_origGossypium hirsutumsequence_feature


Sequence
>BNL2530 ID=BNL2530|Name=BNL2530|organism=Gossypium hirsutum|type=genetic_marker|length=221bp
CACGTCGTTTTGGAGGCTATAAAAGGCCTCTTTTCTTCAAAAAAAATTCA
TTTCTACACTTGANAGAAAAAAGAGAGAGAGAGAGAGAGAGAGAGAGGGT
GGGTGATTTCTGGCCACAAGGCCGGTCACCGTCCGGTCGCCGGACTGCCG
TCGGNCGCCTTCGCCAACCACCACTGGNCACCGTCACCGGNCACCGCGCA
CGGTGGCCAGAAATTTCAAAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr10N/AAD_chr.1014.5BNL2530
2Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr02N/AAD_chr.020BNL2530
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr10N/AAD_chr.1042BNL2530
4Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr02N/AAD_chr.020BNL2530
5TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr10N/AAD_chr.1040.5BNL2530-155
6Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr10N/AAD_chr.1048.2BNL2530-155
7TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr10/A10N/AAD_chr.1052.96BNL2530-155