BNL1681, BNL1681 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1681
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1681_orig
Source Typegenomic
Repeat Motif(AG)11
PCR ConditionAnnealing temperature: 55
Primer 1BNL1681_F: GTGTGTGGGTGTGCATGTTT
Primer 2BNL1681_R: TGGGGAGACTTTATCACGCT
PolymorphismP_ BNL1681
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1681_FBNL1681_FGossypium hirsutumprimer
BNL1681_RBNL1681_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1681aBNL1681aGossypium hirsutummarker_locus
BNL1681bBNL1681bGossypium hirsutummarker_locus
BNL1681BNL1681Gossypium hirsutummarker_locus
BNL1681-110BNL1681-110Gossypium hirsutummarker_locus
BNL1681/110t(C21)BNL1681/110t(C21)Gossypium hirsutummarker_locus
BNL1681_112BNL1681_112Gossypium hirsutummarker_locus
BNL1681_110BNL1681_110Gossypium hirsutummarker_locus
BNL1681BNL1681-119.7Gossypium hirsutummarker_locus
BNL1681BNL1681-85.62Gossypium hirsutummarker_locus
BNL1681BNL1681-165.5Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1681_origBNL1681_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A11chromosomeA11:18299866..18299975 +
CM018225.1chromosomeCM018225.1:15118232..15118346 +
CM018212.1chromosomeCM018212.1:17657800..17657928 +
D5_11chromosomeD5_11:50874907..50875034 -
KI_11chromosomeKI_11:11724228..11724339 +
Chr4chromosomeChr4:53041764..53041876 +
Chr4chromosomeChr4:53047248..53047362 +
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:105506068..105506179 -
Chr7chromosomeChr7:39570849..39570976 -
D10_11chromosomeD10_11:14656013..14656144 +
CM016624.1chromosomeCM016624.1:23658308..23658424 +
Dt_chr7chromosomeDt_chr7:13035296..13035421 +
At_chr7chromosomeAt_chr7:993355..993465 -
D11chromosomeD11:15423563..15423688 +
A11chromosomeA11:18075538..18075648 +
Ghir_D11chromosomeGhir_D11:15738729..15738854 +
Ghir_D11chromosomeGhir_D11:15762890..15763016 +
Ghir_A11chromosomeGhir_A11:18410090..18410200 +
D11chromosomeD11:15360532..15360657 +
A11chromosomeA11:17827321..17827431 +
D11chromosomeD11:15742940..15743063 +
A11chromosomeA11:18131971..18132079 +
D11chromosomeD11:15526253..15526378 +
A11chromosomeA11:18549695..18549805 +
At11chromosomeAt11:19492307..19492419 +
scaffold56supercontigscaffold56:281025..281137 +
scaffold4113supercontigscaffold4113:52314..52439 -
scaffold4113supercontigscaffold4113:47657..48052 -
Gbar_D11chromosomeGbar_D11:15416957..15417071 +
Gbar_A11chromosomeGbar_A11:17432907..17433035 +
D11chromosomeD11:15357651..15357776 +
A11chromosomeA11:17646294..17646422 +
CM017633.1chromosomeCM017633.1:15282393..15282505 +
CM017620.1chromosomeCM017620.1:18130822..18130938 +
CM017659.1chromosomeCM017659.1:15567360..15567485 +
CM017646.1chromosomeCM017646.1:18270941..18271059 +
CM017711.1chromosomeCM017711.1:15389566..15389680 +
CM017698.1chromosomeCM017698.1:17930118..17930232 +
Chr07chromosomeBNL1681:1..246 .
Chr07:14808688..14808950 +
Chr7chromosomeBNL1681:1..246 .
Chr7:39570820..39571082 -
Sequence
>BNL1681 ID=BNL1681|Name=BNL1681|organism=Gossypium hirsutum|type=genetic_marker|length=111bp
GTGTGTGGGTGTGCATGTTTACGTATAGAGAGAGAGAGAGAGAGAGAGAG
CACCGAGAGAGAGACCTTTTATTCGTCTGAGTTCCTTACATAGCGTGATA
AAGTCTCCCCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr11/lgA03N/AAD_chr.11143.2BNL1681a
2Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr11/lgA03N/AAD_chr.1185.3BNL1681a
3Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr21/lgD02N/AAD_chr.21162.3BNL1681b
4Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr21/lgD02N/AAD_chr.21100.7BNL1681b
5Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c11N/AAD_chr.11131.68BNL1681
6Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.21104.69BNL1681
7Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch21/lgD02N/AAD_chr.21101.68BNL1681
8Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr11/lgA03N/AAD_chr.1159.1BNL1681
9Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr11N/AAD_chr.1170BNL1681
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.11249BNL1681
11Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg8/chr11N/AAD_chr.1140.2BNL1681
12Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.1N/AAD_chr.050BNL1681
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.1984BNL1681
14AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.21165BNL1681
15Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr21N/AAD_chr.2192.8BNL1681
16Yumian-1 x T586, RIL (2006)YT-RIL_chr21-3N/AAD_chr.2171BNL1681
17Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-1N/AAD_chr.050BNL1681
18NemX x SJ-2, RIL (2005)NS-RIL_chr11/lgA03N/AAD_chr.11286.5BNL1681
19Yumian-1 x T586, RIL (2015)YT-RIL.15_chr21N/AAD_chr.2198BNL1681
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.11107.8BNL1681-110
21TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.11104.19BNL1681-110
22Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD08.2N/AAD_chr.1951BNL1681-110
23Yumian-1 x T586, RIL (2009)YT-RIL_chr21N/AAD_chr.2191.7BNL1681/110t(C21)
24GB713 x Nem-X, F2 (2011)GN-F2_chr21N/AAD_chr.21115.1BNL1681_112
25TM-1 x Hai-7124, BC1S1 (2007)TH-BC1S1_chr11N/AAD_chr.1173.1BNL1681_110
26Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.21119.7BNL1681
27Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch21/lgD02N/AAD_chr.2185.62BNL1681
28PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.11165.5BNL1681